Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1752
Length(NT) : 890
Best Gene Model Blast : Link to GSTUMT00012092001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein BC1G_11739
Accession: ref|XP_001549981.1| Score: 132 E_value: 5e-06
KEGG Definition: hypothetical protein
Accession: fgr:FG07231.1 Score: 127 E_value: 9e-06
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1752
TTGGATCAAGATCGGCAATGGAGAGGTGGCTAGAGCTAAGAAGAGGGTCG
GGAGGCGGAGAGTTGTCGAACTGAGCCGGGATGATAGCGATGTGTCGATC
CACCAAGATATGCAATCAAATACAAAGCCGACAGCTATTAGATCGACCTC
ACAGAGTAGGCCGGTGGTTGTCTCTTCGTCAAAGCTACCGACAGCGCCCA
AAGAGATATATCACCCGCCAGAGGAGACGTCGTCTGGTGCAGAATCCTCT
CCTCCGAACCACCACTCTTCACCGAGTGAGAATGTCGATTGGGCTCAGAA
GGGAGACGAGTATAGACGTAAGGTTGAAGCTCTCAGGAGCGAAGTTGGAA
GCGGGTGGTTGAGTGTATTGAGCGAGGAGGGCATGTCATTGGCACCGTCG
CGGAAGGTTTCGTCGCCTTCGACGCCGGCATCGGGACCTGCTCAGCAGAA
GTCGGACTAACTGTGTTTTGTTTCAATGTCTGCTTACAGGGGGGTGTTCT
GCTACGGAGTTGACGGGGTTGAACTTGCATAAGTGGGAGGGGTCATTGAA
GATGGTTAGTGGAAATGATGAGCATCACGATTTAACGCATGTTTTTTTTT
TATCTCATTTATTTATTCGAAATTCGACACGAAGAGGTCTTTTTCCTTTC
ATTCTTTCCTGCTTCTCTCTTCTCTCTCTGGGGGTTCTTCTGCTTCCTAC
TGTACCATAGGTTTGTGTTTTAATCGTTGGGTCGGGAGTTAGGCTGGGCT
TATCATTTCGTTTTTTGTTGCTGTTCTTTTGTCGCTTGAATTCTCAAATC
CAGGTTCGTTTATTTACCAATGTGTTTGTTTTCTTTTTCGTTCTCTTTTA
ATATTTTCTCATCCTTTTGATTGCCCCCCTCTTCGATTCT

Sequences in the Contig:

SY0AAA60YN19FM1 SY0AAD21YN24FM1