Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1751
Length(NT) : 394
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 3

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1751
TTGGCATCCCCCCACCTCAAAGACTCGGAAATAGAAGGAAATAAATACTA
AATACTACTCGTACAGCTTCCAGTGTGCTGCAGCTAGGAAAGAAACGGCA
AGTTTGCATAGAGACTACCGTATCCATACCGAGATCCTCCCAATTCCACT
GCCGTTTGACACATTTCAAAGTGACGGAATCTCTTCAGAGTAAATCAGGA
CTTCCCCGAGCGGATCTGTGTGTGGTCAGGGACGCGGCAAGAAAAGAAGT
GGTGGTCGTGGTTTCCTCAGCAAACTTGGGCGGAAAAAACCAAAACGAGA
GCTAGAGCCAGGTTTGCGGTTTCTCATCCAACCCAACAACATCGCACACT
ATTTCTCTTTCTCCTCTCGTTCCCTCCCTCGCCCCCCCCCCCCC

Sequences in the Contig:

SY0AAA60YN03FM1 SY0AAD49YK01FM1 SY0AAD59YH17FM1