Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig175
Length(NT) : 3107
Best Gene Model Blast : Link to GSTUMT00006442001 E-value : 0.0
Numbers of ESTs : 21

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE61949.1| Score: 2026 E_value: 0.0
KEGG Definition: eIF-2alpha kinase GCN2 [EC:2.7.11.1]; K08860 eukaryotic translation initiation factor 2-alpha kinase
Accession: aor:AO090701000211 Score: 2026 E_value: 0.0
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG1035 Score: 1111 E_value: 1e-121
PFAM Definition: Pkinase, Protein kinase domain..
Pfam Number: pfam00069 Score: 355 E_value: 6e-34
Swissprot: Q9HGN1|GCN2_SCHPO
Gene Ontology:
GO:0043561 = Biological process: regulation of translational initiation in response to osmotic stress

Sequence:
>Contig175
TTGGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGGAACTGGTGGTTT
GGATTTCATAAGTGGGGGTGGATATTCAGATGTCAGCTTTGAAGATGACA
GTGATGAGCCAGACGAATCGGAGGACGAGGAAGCAAATGAAGAGGGAAAA
GAGGAAGATGTCCTCAAAGCTATGAGAAACCGCGATGGAAAGGGCCGGGC
ACCCATTGTTAGAAGGAAATCTAGTAGCGGGAAAAGCTCCAGGTCTACCT
TATACATACAAATGTCGCTCGCCGATCAACTGACCATAAGAGATAAAGTC
CTTAGCGGCTTGCATGCCGATGAGGCCTGGAGATTACTTCGGCAGGTTCT
CGAGGGATTGGCACACATCCATGGACTTGGGATTATCCATCGTGATCTCA
AACCCGAGAATATATTTATCGATTTAAATGGGAATCCGCAGATAGGAGAT
TTCGGGTTGGCTACCAGTGGACAGGTGTCAAACAAGGCCAACCAAGCTGA
ATCAGATGATATAGATCTAACCACCAATGTTGGAACCATTCTCTACGTAG
CTCCGGAATTAAGGACCACCAAGGGCCATGGAAAATACGATGGAAGGGCA
GACATGTACTCTCTTGGGATCATATTCTTCGAGATGTGCTACATTCCTCT
TGTCACGGTTATGGAACGTGGGAAAGTCATTGGAAAGCTCAGAGAAAAGG
AGGTCAACTTCCCGTCTGATTTTGCAACAGACAAGAATGCAGTCCAAGTC
TCTATCATCAAATCGCTACTCAGCCATGATCCGGCTGAGCGGCCATCGAG
CATGGATCTGCTAAACTCTGGGAAATTACCACTCAAGGTCGAAGATGAAA
CTATGCGTCAAGCGTTACGAAGTATCTCGAATCCCGGGACTCCTCATCAT
CAGCAGGTTATGTCTGCGCTTTTCTCTCAGAGTACCAAGGAGTACAAAGA
CCACACCTACGATCCTGGGAAAAGCATCCTCTCGCGCCACGATATTATCC
TCCAGGGAACGGTCAGAGAGCGTCTCATCGAGATATTTAGGCACCATGGA
GCTGTAGAAACCACCAGGCCACTCCTACTCCCCCGAAGCAAGCTTTACAA
CCGGGATGTTGCGCAGCTGTTAGACCAGAGCGGAACAGTCGTACAGTTGC
CGTATGATTTAACATTACCCCATGCACGATCATTGGCTAGGCAAGAGACT
CTTAGTCCAAAAACCTTTACTTTCGGGACAGTATACAGGGACAACCCAGC
GGGTGGTCAACCTCGAAGCCATGGAGAAGTTGATTTTGATATTATTAGCT
ATGACAGCCACGATCTTGCGCTCAAGGAGGCTGAAGTGATAAAGGTTATT
GACGAAATCCTAGATGCTTTTCCTAGTTTGCGTAAAGCCCAAATGTGCTT
TCACATCAATCATGCAGACCTTTTGGATATAATTATGGAGTTCTGTAGGA
TCAACCCAGCACATCAACCTGTTGCAAAGGAGACCCTGAGCAAACTCAAC
ACTGGTCAATGGCTTTGGCCCAGGATTAGAGATGAACTGATTATCTCTGG
ATTAGGAATCTTACCAACTAGTCTTGACGACCTTGCCAAGTTCGATTGGA
GGGACGAACAAGAGAAAGCACTTAGCAAGCTAAATCTCCTTCTTCGTGGC
TCAAACCTAGCTGATAAGGCAAAAACAGCCTTCGCTCATATACGCGCTGT
GATCGGATACCTAAAGCAATTTGGCATCACAAGGGATATATACGTCAGTC
CCCTTGGAACCTGGAATGATAAGTTCTATCGTGGAGGTGTTGTTTTCCAA
TGCGTTGTTGACTCCAGGAAAAGGGATGTCTTTGCCGCAGGCGGTAGGTA
CGATAGCTTGGTACAGAGCCATAGACCAGCCGTCCGAGGTATTGCAGAGG
AAACTCACGCCGTCGGGTTCAACTTAGGCTGGGAGAAGCTCTTCACCTCT
GTGGCTCGTTTCCAAAAGAACTATGCCAAACCGCAACACAAGAGAGGCGA
AGATGAGAACCTCAGACCATGGGTGACTAGGCGCTACGATGTCCTTGTAG
CTAGCTTTTGCAAAACGGCCCTCAGAACTCAGGGAATAGCAATATTGCGG
GAATTGTGGGCAAACGGTATCAGTGCAGAGCTGGCAGGTGATGCTTCCAG
CCCAGAGCAGCTGATCAATAGTTACAAAGGAGACGGCATATCTTGGATCA
TCATTATTAAGCAGGGCTTTGGTTCTTCCCTAGACGGAGACCGCTGCTTG
AAGGTGAAGAGCTTGCTCAGAAAGGAAGATGTCGAACTCAGAGTCGCAGA
CATGGTACCGTATCTGAAGAACGAGATTATTGAAAGAGAAAAGAAAGAGA
GGTCTTCCACTATTTCGGGAAGCCCGGGGGTGCTGGCGGGGATGAAATCC
CTTACCAGACACCCCAGCTCCGGTGGTGAAATACCTGGGCGTCAGGCAGG
AGATGACGGTGACGCGGGCGTGAGGATTCTCGCGAGTGATCGAAAAGGCA
GGAAAATTAGCAAGGGTAACATTATCAGTGCGGCTCAACGCGCAGCATCT
GAACTTCTCACAAATTTCTTCCGCGACGCTCCGATTGCCGCCATCGACGT
ACGAGATGACATCCTCCACGCGATCAAATATGCAGGCCTTCACGACCAAG
AGGCTTGGCGAAAAATCATCCAGGGCTCCCCTGCCGTCGATAGGAAATAC
ATCTCCCAAGTCCAGGATCTACTTGTGGACCTCAAAGAAAACTCCCGGAC
CAATGGATGCCTCGTATTTAATTACCGTACCGGGGTGATTGTTTTTTACC
ACTTGAATTGAATCGAGCCCAGCTCAGGTTAGGAGCATGGTGGATGGAGT
GCACATGTGTAGGAGGTGATAGCTGGATTTGTGGTATCTTTTTTATGATT
TATTTCAAATTCTCTACTCTGCTCAGGTTTTCTTTTTGCCCTTTTTCCAT
TTCCATTTGGTGTATCGTAACAGTAATGGGGCGATGTGTGGCTCCTTTCT
TTTCTCCCCCTTTTGCGTTGTAGCACCGTAGGTGCTTTGAATACCCCTCC
ATCTGTAATCTGTCGCCTGGAGTTCGATATGTATCATAATTTACCTTTTT
CTCTTTG

Sequences in the Contig:

SY0AAA16YG17FM1 SY0AAA44YM08FM1 SY0AAC13YA09FM1
SY0AAC21YA12FM1 SY0AAC21YA12RM1 SY0AAC34YF01FM1
SY0AAC38YL18FM1 SY0AAC39YB09FM1 SY0AAC39YI17FM1
SY0AAC49YM22FM1 SY0AAC50YB13FM1 SY0AAC55YK07FM3
SY0AAC58YD09FM1 SY0AAD20YN15FM1 SY0AAD33YK04FM1
SY0AAD39YC12FM1 SY0AAD3YP10FM1 SY0AAD45YM22FM1
SY0AAD53YL20FM1 SY0AAD61YH24FM1 SY0AAD7YG03FM1