Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1749
Length(NT) : 1156
Best Gene Model Blast : Link to GSTUMT00010676001 E-value : 0.0
Numbers of ESTs : 7

Blast Results:

Nr Definition: hypothetical protein AN2245.2
Accession: ref|XP_659849.1| Score: 722 E_value: 1e-112
KEGG Definition: hypothetical protein
Accession: ani:AN2245.2 Score: 722 E_value: 1e-112
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: Q5BB35|CWC2_EMENI

Sequence:
>Contig1749
TTGGGTTAACGATAGCTCACAGCCCCTAAAGTCGCCGTCATTGCTTAAAG
AAATAAACACGATATCCGATGGCCGAATCACCTCCTCAGTCTCCAGGCTC
AACAGCAGAAGAAATGCGTGAACCTACCCCCGATGCACCTGCCGCGGGAA
CCAATCCCGATTCCGCCGTGGCAAACACCACCGCCGGAGGAGACTCGGCA
GCAGCCCCAACGGCTCTAACGAAGCCAAAGAAAAGCACCAAAAAGAAACG
CCGTCCAGCCCGTCCGCAAGTTGACCCGTCAACCTTCAAAGGCGGCGAAA
TCCCTGCTCAAACGGGTACGGTGTTCAATATTTGGTACAACAAATGGTCT
GGCGGCGATCGCGAGGACAAGTACATATCCAAGAGCCACGCTGAGGGCCG
CTGCAACATTGCTCGCGACTCAGGATACACAAAGGCCGATAAAGTCCCTG
GAAGCTACTTTTGTCTATTCTTCGCGAGGGGATTGTGCCCTAGGGGTGCC
GATTGTGAGTACCTTCATCGATTGCCGACGGTTACGGATCTTTTCAACCC
AAACGTGGACTGCTTTGGTCGGGACAAGCATTCCGATTACAGGGATGACA
TGGGTGGTGTAGGAAGCTTCATGAGACAGAATCATACCCTTTACGTTGGT
AGGATTCACGTCAGTGATGAGATAGAGGAGATTGTCGCAAGGCATTTCGC
AGAATGGGGGCAAATCGAGAGGAGTACAATCCCCATACTATCACATGCTT
TTTTCTCTCCTTCTAATATCATTTATCTCATGGGACACTATTGCTGACTA
AATTTCTAGTTCGAGTGCTCAATTCTCGTGGTGTTGGATTCGTCACATAC
TCCAACGAAGCAAACGCTCAATTCGCGAAAGAAGCAATGGCACATCAGTC
TTTGGACCATAATGAGATCCTGAACGTTCGCTGGGCCACAACAGATCCCA
ACCCTATGGCGCAAGCACGTGAGAAGCGACGCATAGAAGAACAGGCTGCT
GCTGCTATTCGGCAGGCTCTCCCCGAGGAGTTCGTTGCTGAGTTGGAGGG
GAAGAATAAGGATGCTTCGAAAAAGAGAAGGATCGAAGGTAGTTTTGGGC
TGAAGGGATATGAGGTTCCGGAAGAAATATGGTATGCTAGAGGGCCCAAT
GCTGTT

Sequences in the Contig:

SY0AAA60YL24FM1 SY0AAB12YC18FM1 SY0AAB22YD23FM1
SY0AAC10YN01FM1 SY0AAC50YF01FM1 SY0AAD38YD01FM1
SY0AAD4YO12FM1