Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1748
Length(NT) : 1256
Best Gene Model Blast : Link to GSTUMT00011468001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: hypothetical protein An01g03060
Accession: ref|XP_001388740.1| Score: 1013 E_value: 1e-108
KEGG Definition: hypothetical protein
Accession: ang:An01g03060 Score: 1013 E_value: 1e-108
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0942 Score: 917 E_value: 2e-99
PFAM Definition: HECT, HECT-domain (ubiquitin-transferase). The name HECT comes from Homologous to the E6-AP Carboxyl Terminus..
Pfam Number: pfam00632 Score: 741 E_value: 4e-79
Swissprot: Q80U95|UBE3C_MOUSE

Sequence:
>Contig1748
TTGGGCCGAGAACGCTACCGAATTAGGCAAGAATCTATTTCTGGAGAATG
AGCAGCATTTGTTGTACCCCAACCCGACGAGCATCGAGGAACTCAAGGAG
GAGCTTATTAAGACAAGAGGCCCCTATCAAGAGGTGATCGGGGATGAAGT
TAAGCCACTATCGAAAAGGTACGAATTTCTTGGAAGAGTGCTCGGGAAGT
GTCTTTACGAAGGAATTCTTGTGGATGTTGCTTTCGCCCCCTTCTTCCTC
CTCAAATGGAGCCAACAAGCCTCAGATTCTAGAGCTAGCATGGCCATTGG
TGTCAATGACCTCCGAGATCTTGACGAGGGCCTCTACCGAGGACTTGTGA
AGCTTAAGAATTACACAGGCGATGTCGAATCCGACTTCGGGCTTAATTTC
ACCATTAGTTCTCGGATTCCAAGACACGACAAGACTATCACAGTGGAACT
TAAACCTGGTGGGGAGACAATTCCAGTTACAAACGCAAACAAGCTTGAAT
ACGTCCACCTCGTTTCCCGATACCGACTATCCGTACAGGCACATATCCAA
ACCTCGGCCTTTCTGAAAGGCTTGAGCTCGATTATAAACCCAAGCTGGTT
ATCCATGTTCAATCAATCAGAGCTACAAACTCTAGTAGGTGGGGATATCA
ATACGCCGATTGATGTGGAAGATTTGAGAAGAAATACTATCTATGGAGGT
GTTTACCAACTCGGCGAGGATGGTATTGAGCACGAGAGCATACGGCTGTT
CTGGGAGGTCATGCGTTCCCTTGGCGATGAAGAACGTAGGAAGGTCTTGA
AGTTTGTTACTAGTGTTGCTCGGGCGCCGCTATTAGGTTTCGGAGTTTTG
AGGCCAAGATTTAGTATCAGAGATGCGGGTGAAGACCAGGGAAGACTTTG
TAGTGCTAGTACTTGCGTGAACCTTCTCAAGCTCCCCCGTTACAGGGATC
CCAGAATCCTTCGAGAAAAACTCCTTTACTCCGTCAATTCAAACGCAGGC
TTTGACCTGTCTTGAGCTATCTTAACCAATCATACAATACTTTTTCGCTT
ACTTTGCTGTCGCCCTTGAATTATATCTTATCGCCTACTTTTTACTTTTT
TGATAATGGGGAGTACCTGGTAGCATGCGTCATTTCTCTTCCTTTCTTGT
ACTTGCTTTACCTGGGAGGCTAGTTTGGGTGTAGATACTTTTATTCTATG
GAGGATACTTTCTTTTTCGTCTGGGTGGTTGGTGGAGGGGGGTGGGGAAT
TTGAAT

Sequences in the Contig:

SY0AAA60YL20FM1 SY0AAC6YJ10FM1 SY0AAD15YK14FM1
SY0AAD7YC21FM1