Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1747
Length(NT) : 1286
Best Gene Model Blast : Link to GSTUMT00003971001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001537469.1| Score: 140 E_value: 1e-06
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1747
TTGGGCCGCAGAAGAGCCCTCAACCTGTGTCTGGAGTAAGTAGTGTAGTA
TAGTTAAGCTCTACTTATCGCTTGGAACAGATGCTTCCCCAAAATTATGT
CCTCCCTGCGAGAGCGCGACTTGAGATCCTGCTCGTTCTCGCCTTCGCCT
GTAACTCTGAAGCAGCTTCAGGTGATTCCCCGATATCCTCTTCCTCCGAC
GTTTGGGCCACACTCGTGGCGAACATCGCCCCACTACTGGTCCTGGTTGG
CGAGAAGCACGTAAAGGCATACTTTAAAAATATGTGCCGGCCATCGCACC
ACTTACTCTTCGCTTCCGCGCCCATAGGGCTTGTCACCGCCGTAACTACT
TTGATCCGACTGAACGGCACACCAGTGCTTAAGCGAATGATAGGTCGACA
ATTTGAGACGAGGGCTGAAGTTCTCGCCGATGTGACTTCTGTCTCTGGGG
GTGAGGTTGGGTTGGAGCTGCGGAATATGAACCTGGAACAGACTATTCAA
CCAACCGACGAGGATCTTGCTATGTTTTGGGTACACGGGAGAACGGAAGG
ATCGCCAGAGGAGGTTGCAAAGACCTTTACGGGTTGGGTTGGGACTCTCA
TGGGGATTGGCTATGCGGCGGCCAACTCTGCCTCTTTATATTACGATAGA
AGGTGCTCATGGGAGATGATGATGTCCTTTAAAGCCACGGGCACCTGCGC
ACGGTGGGTTGCAAGGGGACATGCGGCAGAATCGCGTAACTTGCCAGAGC
TTTCGGGTCAATGCGAGAAGAAGGTTGTTGCGGAAAAAAACTCTGGAGAC
ATAGCAACATGTACGGCGTCAGCAGCAGTGTATGCTAGATTCACTGACGT
TTCTTTGGGCTTAACGGCTAGTGTCAACCTCGACGATGGAAAACTGGAAA
TTGTGAGGTACGCAATTATTGTGCTCTGCTCGATGGGAAATGTTGGGATA
ATTCTTGCAGCCTGGTTCAGGGGCCGTGATCCCAGAGATGTAGGACTTGT
TGGCGCAGGGCTCTTTGTTTCCTGCGCTGGCTCTTGGCTCACTGCGTGGC
TTGTGGACGAAGCGTCGGAGGAGACAATTCTTGATATGTCTCAATTGTCG
GCTATTGCCTCGGGCTTTTTCTCGGATAGGATTCCTGAGGGAACGGAACT
CAGTTTTTGCCCCAAGAAGATTGCAATTTCAACCGATGCTCGCCCCGGAA
TGAGGGGGGGTGTGGCCAAAGTAAGAGGATGGATGTCTACGGTAGCTGTT
GTCGCGATGGTGTTGGCGTATACTGGGCTATACTTG

Sequences in the Contig:

SY0AAA35YB19FM1 SY0AAA60YK17FM1 SY0AAB54YL10FM1