Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1746
Length(NT) : 597
Best Gene Model Blast : Link to GSTUMT00001086001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: GTP cyclohydrolase I
Accession: ref|XP_001242620.1| Score: 237 E_value: 3e-40
KEGG Definition: hypothetical protein
Accession: ang:An09g05310 Score: 241 E_value: 5e-40
KOG Definition:
Classification: [Coenzyme transport and metabolism].
Kog Number: KOG2698 Score: 245 E_value: 5e-22
PFAM Definition: GTP_cyclohydroI, GTP cyclohydrolase I. This family includes GTP cyclohydrolase enzymes and a family of related bacterial proteins..
Pfam Number: pfam01227 Score: 112 E_value: 1e-06
Swissprot: P51599|GCH1_NEUCR

Sequence:
>Contig1746
CTCCCCATACTTAATCTACCTTGCTATTCAAAATGCCCCCACCAATAAAC
ACGGACCAGCTAACCAACCAAATCGATCACCGTGTGTTCCGGATCCGTGA
GAATGGAGGCCCCGCAAACGATATCGTGCCGACCGAATCTACCACTAATC
AGCGAAGGCGGACGTCCATTGCTTTGGCTCTTGGCGATGCGCACCCCCGC
GCAGAACTGGAGGCTTCGAGACGGCAGTTCGTTGATTATGACGGATTGTC
GTGGCCGAGTTCGGGCACGAGGGAAAGGTTAGAAGCTACGCCAGCCGAGG
CGGAAGCTAGGCTTGAGAAGTTGTCTGGGGCCGTATAGAATTAGGACGAT
ACTAGAATGTATTGGCGAAGACCCCGACCGCGAGGGTCTCCTAGAGACAC
CCTCCCGATACGCAAAAGCGATGCTATACTTCACGAAAGGTTACGAGGAG
AACCTCAAGCTAATCATCAATAACGCCGTTTTCCGGGAAGACCACGACGA
AATGGGTTCTTTACATAATAGTCAAAGACATTGAAATCTACTCCATGTGC
GAACACCACCTGGTCCCTTTCACCGGGAAGATGCACATCGGCTACAT

Sequences in the Contig:

SY0AAA60YJ22FM1 SY0AAB30YP02FM1 SY0AAB46YO11FM1