Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1745
Length(NT) : 812
Best Gene Model Blast : Link to GSTUMT00000015001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: hypothetical protein BC1G_10189
Accession: ref|XP_001551363.1| Score: 671 E_value: 1e-82
KEGG Definition: hypothetical protein
Accession: ang:An18g03300 Score: 666 E_value: 4e-81
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG2472 Score: 579 E_value: 2e-60
PFAM Definition: No Hit Found
Swissprot: O42849|SYFB_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus
GO:0009328 = Cellular component: phenylalanine-tRNA ligase complex

Sequence:
>Contig1745
TTGGGCTCGAGAGAGAAAGAAAAAATAAAAAATCCTATCGTACAGCAACA
CAGTAGAATCTCGGCTCGGATTGACTGACCTACCAAATCGATAATGCCGA
CTGTTTCTGTCAACAAATATGACCTTTACGAGGCGCTCGGCCAACAGTAT
ACAACCGAGGAGTTCGACGATCTTTGCTTTGAATTCGGAATCGAACTAGA
CGAAGATGTACAATTTACATATTTTCCTAATCTATCCTGCTCGTTGATCT
CCCTCGAAGTCTGCTAATTATCAATTAGACAGAGAACGATCCCGACAGAC
CTAAAGATCAGCCCCCTCAGCTGAAGATAGAGATTCCCGCGAATAGATAT
GACATGCTCTGCCATGAGGGAATTTCCTTGATGCTTAACATCTTTCGCGA
GAAAGCATCTATTCCAAATTATCGTGTTGTTTCCCCCCCCAATGGTGAAG
TTCACCAGATTATTGTTCATGAAGAGACCACCAAAATCCGCCCATATGTG
TCTGCTGCTGTGCTACGAGGCATCAAGTTTACCCAGGGCCGTTATGACTC
CTTCATTGCCCTCCAGGACAAGCTCCACCAAAACCTATGCCGACAACGCA
CCTTAGTGTCTATGGGAACCCACGATCTAGATACCGTCAAGGGCCCATTT
ACATATGAGGCTCTTCCCCCAGAAGAGATCGTGTTTGCTCCCTTAAACAA
GGAGGAGGTAATGAACGGTAAGCAGTTGATGGAATTCTATGAGAACGATA
AACACCTCGGAAGATACCTCTATATTATCAGAGATTCCCCTGCGTACCCA
GTGATCCTTGAT

Sequences in the Contig:

SY0AAA47YF08FM1 SY0AAA60YD17FM1 SY0AAA60YJ15FM1
SY0AAD35YD05FM1