Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1744
Length(NT) : 1317
Best Gene Model Blast : Link to GSTUMT00010482001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: 5'->3' exoribonculease Dhp1
Accession: ref|XP_001264385.1| Score: 343 E_value: 3e-30
KEGG Definition: 5'->3' exoribonculease Dhp1 [EC:3.1.11.-]; K01146
Accession: afm:AFUA_1G13730 Score: 337 E_value: 7e-30
KOG Definition:
Classification: [Replication, recombination and repair, RNA processing and modification].
Kog Number: KOG2044 Score: 202 E_value: 1e-16
PFAM Definition: Gag_spuma, Spumavirus gag protein..
Pfam Number: pfam03276 Score: 117 E_value: 1e-06
Swissprot: Q8TFZ1|XRN2_ASPFU

Sequence:
>Contig1744
TTGGGGACAACTTTGTACAAAAAAGTTGGCTAACTCCTGAGGACGATGCG
AGGAATGCAATGGGACATGATCTTCTATTCTGTTCAGTAGAAAACGACAT
GTACGACGATGTTGCCATACGATTCTACTATAAGGGCCGGAGTGACGACG
AATACGACCTTGACCCTACGAAGAGCCAAGGACTGTCTGGAAAGGTTATC
AAAGATCCTGCTTTCATCCCTCAGGGCACGATACCTTTTCCACTATCCTT
AGAAGATATGCCTAAAATCGAGGGCGACAAATCACTTTGCGTCTTTTACG
AATTTCCCAAAACCAAGAATGCGCACAAATCGATGTTACTTCGTGGGGTC
AAGCTCAGTCCTCCCGTCCTCTCTCATACAGACCTAGAAATGATCAAAAA
CAATGCTCAGAACTCAGGCCGCTCGTACGGTGGCGCTCCGCTTTATCGTA
GCAACAGCGGGAGAGGCCGTGGCCGCGGTAGTGGGGGAGAGTTCCAAGGC
TCCTATCAATCCAATCGAGGTCCTACTCAAAGTTACCAGGGACAAAACCA
CACACCTTCTTATGGAAATGGGACTTGGCAACCTCCTCCACCTCCGCCAG
CTCTCGCAGGTTGGGGCGGATGGGGCGGGCAGCACAACCAGGTTCGGGGA
AATTACACAAATCTGCAACCACCATATATAGCACCAGGACAATACCACCA
GGGCGGTCGATACCCCCCTCCACCCGCTCCTCCTAGATTCTCTCATGCTT
CTAACTTTGGACGCGGGCAGCCTCAAGGCTCATACAATGGAGGCGGTTAC
AACTACAATCAGCCATCTAGGGATGATAGATACCGTCCTGGTGGTGGTGG
CGGTGGCGGTGGTGAGAATAGGTACAATGACCATTACAACGATCGTCGCG
ATGACCGCGGTAGAGGTGGTGGTGGAGGAGGTTACCGAGGCGGTCGTGGG
GGTGGAGGTACCAATAGGGCCAGAAGTGACAATACTGAACTCTGGAGAAG
ATGATTTCCTTTCGTTAAACCATATGCTTTACGATGTACATCTTTGTTAT
CATTGCAGGCCGGGCTTCTATTATCTTGTCTATATTCGGCTATTTTTGTT
TCCTTCAATTCCGTTTGTCTTTCTTACTTTTTGTGTAATGACCTCCCCGT
GCATGTAAATTGCGTTTCGGTGTTGATCAATGAGAAAACACCGAAATGCA
AAGCCTATGATCACGCCGCGGTTGTCGCTTAGGGGCGCGGTTCTATCACG
TTTTCAAACCAGAAGCGTGCAGCGCGTAGGCTTCAAACTATGATTCGAAT
TTGGTGTTGTTTGGAGG

Sequences in the Contig:

SY0AAA48YO10FM1 SY0AAA60YH11FM1 SY0AAB54YB21FM1