Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1743
Length(NT) : 796
Best Gene Model Blast : Link to GSTUMT00000616001 E-value : 1e-88
Numbers of ESTs : 13

Blast Results:

Nr Definition: ubiquitin-conjugating enzyme type E2
Accession: emb|CAA73327.1| Score: 560 E_value: 9e-56
KEGG Definition: hypothetical protein [EC:6.3.2.19]; K10576 ubiquitin-conjugating enzyme E2 H
Accession: spo:SPBC211.07c Score: 543 E_value: 4e-54
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0416 Score: 561 E_value: 2e-58
PFAM Definition: UQ_con, Ubiquitin-conjugating enzyme. Proteins destined for proteasome-mediated degradation may be ubiquitinated. Ubiquitination follows conjugation of ubiquitin to a conserved cysteine residue of UBC homologues. TSG101 is one of several UBC homologues that lacks this active site cysteine..
Pfam Number: pfam00179 Score: 281 E_value: 6e-26
Swissprot: Q9P7R4|UBC8_SCHPO
Gene Ontology:
GO:0004842 = Molecular function: ubiquitin-protein ligase activity

Sequence:
>Contig1743
TTGGGATAAACAACGTATCGTAGGCCAAACCCCTCTCTTTCTCCCTCTCA
CCTTCTTGCTCCCCCCTTCCCTCCTGCTCGCCTTGTCCGTGCTTCATCCT
CCTCTCCTCACTTGAAGTATAGGTTCTCGAATACAAACTTCAACCCCTCG
TTCTATTGTCTCGCATCCTCATCCGCGTTCAACTCTATTCCCACCGTTTT
CTATCTATCCAGCGTGCCAACCATCTTCCGCCCGCGCCCGACCATAAATT
TACCATTGCTTAAAACGCCGCACCCGACCCTTCTCTCTGACAGCTCCACA
CCACTCCCACCATACCAACAGCCGTCCATTATCTTGCGCTGCACACGTCG
CTACATAAATAACCCCACCTCGGTTCCAACTGTCCTTTCAACCAATCCTC
CCTCTTCGCCTCCCTCCCACAGATCAACGCGGAAGAGCAGTTTCACTTAA
GCTACCTAGGGGCCCGCCGTCATGAGTTCTCCAAAGAGAAGGATAGAGAC
AGATGTCATGAGATTGTTGATGAGCGACTATGAAGTCACTCTTGTCAACG
ATAACATGCAAGAATTCTACGTTCGATTCAAGGGTCCTGAAGAAACGCCT
TTTACCGGGGGTATCTGGAAGGTCCATGTCGAGCTCCCCGATCAATATCC
ATACAAATCTCCTTCGATTGGATTTGTGAATCGCATCTTCCACCCCAATA
TCGACGAGCTAAGCGGGAGCGTGTGCTTGGATGTCATCAACCAGACGTGG
TCCCCCATGTTCGACATGATCAACATCTTTGAAGTGTTCCTCCCGC

Sequences in the Contig:

SY0AAA14YG21FM1 SY0AAA2YG08FM1 SY0AAA60YH03FM1
SY0AAA63YL04FM1 SY0AAB15YC21FM1 SY0AAB55YE18FM1
SY0AAB59YF14FM1 SY0AAC21YB24FM1 SY0AAC23YM18FM1
SY0AAC45YG09FM1 SY0AAC48YH20FM1 SY0AAD51YH12FM1
SY0AAD5YK11FM1