Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1742
Length(NT) : 1166
Best Gene Model Blast : Link to GSTUMT00003835001 E-value : 0.0
Numbers of ESTs : 7

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE61449.1| Score: 667 E_value: 2e-92
KEGG Definition: fatty acyl-CoA elongase/Polyunsaturated fatty acid specific elongation enzyme
Accession: aor:AO090102000393 Score: 667 E_value: 1e-92
KOG Definition:
Classification: [Lipid transport and metabolism].
Kog Number: KOG3071 Score: 303 E_value: 2e-28
PFAM Definition: ELO, GNS1/SUR4 family. Members of this family are involved in long chain fatty acid elongation systems that produce the 26-carbon precursors for ceramide and sphingolipid synthesis. Predicted to be integral membrane proteins, in eukaryotes they are probably located on the endoplasmic reticulum. Yeast ELO3 affects plasma membrane H+-ATPase activity, and may act on a glucose-signaling pathway that controls the expression of several genes that are transcriptionally regulated by glucose such as PMA1..
Pfam Number: pfam01151 Score: 542 E_value: 5e-56
Swissprot: P25358|ELO2_YEAST
Gene Ontology:
GO:0005789 = Cellular component: endoplasmic reticulum membrane
GO:0009922 = Molecular function: fatty acid elongase activity
GO:0030497 = Biological process: fatty acid elongation
GO:0030148 = Biological process: sphingolipid biosynthetic process
GO:0016192 = Biological process: vesicle-mediated transport

Sequence:
>Contig1742
TTGGCTCCTTCTATCCCCATTCTCCCTTACACGCTGTCATCCACCATCCA
CCCCCTTCTTGAACACCACCTTCGTGTCAGCAGAAGCGTCATCGTCGTCC
TTCGCACAACGCTCTTTTACGCTCCTCTTACACTCCTTTTACACTTCTCG
CTGCACCCCCGAATAATACTATCATTTTGATTCACGTCTTAATGGAGGCT
GCGGTTATGGATGTCCTGAGGGTCGTCGACATTCAGAAACCTAGCATTGA
TAGACCGTTTGGTGTGCACCTCTGGCCCGTATTTAACGCGCTGTTTGGGA
AGGTTATGGGATATCCCGCTGCGGACTTCCGTTTTGTCCGCGAGGTCACC
CCTATCTCGACGTTCAAGGAGAGTGCGGGTTTGATTATTGCCTACTATGC
AATTATCTTTGGTGGGAAGCTTATCATGTCAAAATTTGGTGCCATGAGAT
TACGAACCCTTTTCCAACTCCACAATCTCTTTTTGACCACTGTATCGGGG
ATACTGTTGGCCTTGTTTATTGAACAGTTGACTCCCACCTTGTATAATCA
TGGTTTATTTTACGGAATTTGTAATGGTGATGGTGGCTGGACCCAGCCCA
TGGTGGTTCTATATTACTTGAACTACCTCACGAAATATTTCGAACTCCTC
GATACCCTTTTCCTCGTTGTCAAGAAGAAGCCTTTGACCTTCTTGCACTG
CTACCACCATGGTGCTACTGCGCTTCTTTGCTACACCCAGCTCATTGGAA
GCACCGCTGTTGTAATCTTGGGTTCCCATCACGTTGAATTTGTTCGTCCA
TGTCGTTATGTACTGGTACTACTTCCAGGCTGCCCGCGGCGTTCAGGTCT
GGTGGAAACAGTGGATCACCCGTCTTCAAATTATCCAATTCGTTATTGAC
CTCGGATTCGTTTACTTTGCTTCTTACACTTACTTCACCTCCACCTACTG
GCCTCACATTACCAATATGGGCAAGTGCGCCGGTGAGGAATTTGCTGCCT
TTGCTGGCTGTGGCATCCTTTCATCATATCTCTTCCTTTTCATTAGCTTC
TACTTTTCTACCTACAGGAAGGGTGGTAAGCGTGCTGCCAAGAAGATAGT
TGCTAATGGCGACATTGCTGTTGATCCCAAGTTCGCCCGGGACACCTTTG
GCGGTGTTGCTAACGG

Sequences in the Contig:

SY0AAA25YP09FM1 SY0AAA60YF19FM1 SY0AAB1YP02FM1
SY0AAB30YC23FM1 SY0AAB45YN04FM1 SY0AAC25YP20FM1
SY0AAD61YJ07FM1