Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1741
Length(NT) : 576
Best Gene Model Blast : Link to GSTUMT00003916001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Cytoskeleton].
Kog Number: KOG0161 Score: 105 E_value: 8e-06
PFAM Definition: No Hit Found

Sequence:
>Contig1741
TTGGCCAACTTTTTTGTACCAAGTTGTCCCCCGCAACACCGACGACGATG
GAACAAAATACACAATCCGCGACCGACCCCAACTCCACTGCATCCCACCA
GGGCGACCCAAACGATAGAGCTGACAATAGTAATGAAGTCGAAGTGGCTG
GCCAGAACGGCACGGGGAACGGAGTATCCAACAATCATAAAGGCCATTCC
TTAGCATTCGATAGCGATCGGGTTGACAATGAGGCCACCGGGAATTCCAC
AGGGCGTAGCGATGCCACAAGTGCAAGATTCCGAGAAGACCTGGGGAGGG
GAAAGAGATCTGACGAGTTAGAAGATTTGGTGGAAAATATGAAGGAGGCT
GCGAAGGAGAAAGAATCTAAAGGTTCTGGGTCTGCGGAGGAATCAGCCCT
TCAAGATTCTCTCAAAAAACGCATCAAGGATCTAGAGATGGAACTCTCGA
CACATCAAGCAGAAGCTACAGCGCTCCGCAAATCTCTTGCAGATCAGAAG
GAAGCGACTACGAAGGATCTAGATGACAGAGGAAAACTGCTAGCGAAGGT
GCAAGAAGAAAAGCAAACCCTTGATA

Sequences in the Contig:

SY0AAA59YK16FM1 SY0AAA60YF02FM1