Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1740
Length(NT) : 717
Best Gene Model Blast : Link to GSTUMT00000237001 E-value : 0.0
Numbers of ESTs : 11

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001213603.1| Score: 527 E_value: 5e-52
KEGG Definition: hypothetical protein
Accession: ani:AN6017.2 Score: 523 E_value: 7e-52
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG0122 Score: 389 E_value: 1e-38
PFAM Definition: No Hit Found
Swissprot: P78795|EIF3G_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus

Sequence:
>Contig1740
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCGATATCCACTCCAATCATC
CACAGCTCCACTAATACTCAACACTATCACGACGATAGCCACAAAAGCTT
CATACAAAATGCCAGATATCGCATCTTCGAGAGCAAACTGGGCTGACGAC
GAGGAATTCGATGACCCATCCGTCCTCCCCCCCCAACAAGTTATTAACAA
CCCCGACGGCACAAAAACAGTCGTGACTTACCGCTTCAACGATAATGGCA
AGAAAGTCAAGACCACCCGTAAGATTCGCACCACCATCGTCAAGGAACAC
GTCAATCCCCGTGTTGCTGAGAGAAAAGAGTGGGCAAAATTCGGAGCTGA
AAAGGGGCACAGTCGTGGTCCGGATCTTTCCACCACCTCTGTTGGAGAAA
ATATCATTTTCCGCCCATCAACTAACTGGAAATCTACCTCTAAGGAGGAC
AACACCGAGGAGAACAAGTTGAAGGATCAGCTTAAGGATAAGAAGGTTGC
TTGTCGTATCTGTAGGGGAGACCATTTCACGGCTAGGTGCCCATTCAAAG
ATACTTTGCCACCTCTCGACGATGCCGCAGCTCCTGCTGCCGAGGAAAGC
CCTGCCGCAGATGGTCCTGGCGCTATTGGTGGTAGCGGTGGTGGGTCCTA
TGTTGCACCTCATCTACGTGGAAAGAAGGGTGCTGGAGAGTCTATGTCTG
GAACTGGTGGCTCTTAC

Sequences in the Contig:

SY0AAA15YE23FM1 SY0AAA44YN09FM1 SY0AAA47YO18FM1
SY0AAA60YE23FM1 SY0AAA6YK13FM1 SY0AAB19YK06FM1
SY0AAC39YA19FM1 SY0AAC42YE22FM1 SY0AAD14YP23FM1
SY0AAD40YE14FM1 SY0AAD55YL13FM1