Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig174
Length(NT) : 722
Best Gene Model Blast : Link to GSTUMT00006298001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig174
TTGGCCCATCCACCACCTCCCTTACTGGATCAAACATCTCTCCAATCCCC
TCCCTCACCGCTCCGATATAACTGCTGCAAACGAGGAAAAGGGAAATAAA
CAAACAGAGGGGTAAATCGTTTCATTGACTTTTGCCTGCCTTCCCCCTCA
ACTCGCTTCGAAAATGAATGCTTTTCGCCCACCGTCGCGTCGGATCACCT
CTCCGGCCCCTTCCTCCTCCGCTTGGACATTGTCCTCCAATCGTTCTACC
CTAAGCTCGTTTCTCGACGAGGAATATGGCTACTACGAATCGATGGGTGG
AATAACTAGCGGTTATTCTGAACTATCCATGTCCTCACAACTATCGTCAT
CGTCCATAGAAGTCCATTCCTATTCTGGTCCGTCCATCTCGCCGCTCTAC
GCTTCCACAAAATCCTCAGCCGGCGGGTTGCGCGGGCCAGGTTCAACGAC
CGCTGGTGTGAAAGGGAACGAACAGACCGGAATCCCGTCAGATATTCTCC
CGCGTTTGCAAGTCCTTCTCAAGAACCAAGTTCTGGTGTTTCTGGAGGGG
GTCGAATATGACGACCTGCCTCTCGGAGCGATGCTTCATAAACACTCGTA
CAAACTCGCCGCCCGTAATGATGAGATACTAGAGGAGGTTCGCCAGGAAG
GTCGCGCAGTGACCAGCGAGAAAGCTCACCTCCGATATTTCAAAGGACTT
TATCGGGTCATACGGAGGTCAC

Sequences in the Contig:

SY0AAA16YG09FM1 SY0AAB49YK10FM1 SY0AAC53YC24FM1
SY0AAD28YO17FM1 SY0AAD34YI17FM1