Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1739
Length(NT) : 1557
Best Gene Model Blast : Link to GSTUMT00005407001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: hypothetical protein SNOG_10206
Accession: ref|XP_001800487.1| Score: 467 E_value: 2e-44
KEGG Definition: hypothetical protein
Accession: fgr:FG09941.1 Score: 467 E_value: 8e-45
KOG Definition:
Classification: [Signal transduction mechanisms, Cytoskeleton].
Kog Number: KOG1703 Score: 274 E_value: 8e-25
PFAM Definition: Tymo_45kd_70kd, Tymovirus 45/70Kd protein. Tymoviruses are single stranded RNA viruses. This family includes a protein of unknown function that has been named based on its molecular weight. Tymoviruses such as the ononis yellow mosaic tymovirus encode only three proteins. Of these two are overlapping this protein overlaps a larger ORF that is thought to be the polymerase..
Pfam Number: pfam03251 Score: 163 E_value: 5e-12
Swissprot: P36166|PXL1_YEAST
Gene Ontology:
GO:0005935 = Cellular component: cellular bud neck
GO:0005934 = Cellular component: cellular bud tip
GO:0005737 = Cellular component: cytoplasm
GO:0000131 = Cellular component: incipient cellular bud site
GO:0043332 = Cellular component: mating projection tip
GO:0030011 = Biological process: maintenance of cell polarity

Sequence:
>Contig1739
CAAAGGTCAACTTCTAGTGCTGAACAACTAGCTAGGCTTCCATCACCACA
CAGAAGATCACAGTCGCCGGGAGGGGCGGAGGCGAGGATGCGTAGAAAGG
AGCGGAGTCTTCCCCCAGTTCCTTCACTCTCCCGCGGCACGACAAGGAGA
AATGGAGAGGAATCGCCACTGGACCCAGTATCTCCGTACACCCATCGTGC
TATGAAGTCAGAAGTTGCACCCTCAATTCCAAAAATGGATGCTTTGAGAC
TAGACACACGATCGCACACGTTTGCCACCAAGAGCGATTCTAAGTCACCC
GGTGGCAGACAGCCCCCGCATCCTGGATTGGGATTGCCCAGGTCTCCGTC
TGTAACGGTGAAGAACCATATCCATAGACGGAACAAGTCTTCGGCAAATC
TGGCTAAAGGACTCCCGCCTCCGCCAGAAGACAACTTACCACCTGCATTA
CCAACAAAAGATCAAGCAGTCCGACGGCGACCCTCTGTTGGAGCCAACAC
AATGTCATCTGGTAGATTGGATAGACGATCTGGCTCTAAACCCCCGACAC
TAAACCGACTATCTCCACCAAGAGCAGACGAATACACCCACTACTCGTTA
GGAAATCCCTATGACCTGGAAGCCCCGGTAGAGCAATCCACATCCCACAT
CCCAAGCCCCTCCATGTCAAGCAATACCTCTTCCGTCTTCTCCCACAATT
CCAAGAGCTCCCGCAGTTCTATGTCCAGTCCCCCAATCCCTGAGACCTCC
CAAGTCCCTAAACTCCCCCCCAAACCTTCTCGAGGGAGCCGTTGCCGGTC
AAAGGACAGCAATGGGCTGAGCGACATCGATGGCTTAATGAAAGAACTCC
AAAGTTCAATGCAAGAACTCCAACCTAGCGCCGTGCCGCCAAAGCACCCA
GTTGAAGGCCGACCTCGAGATAAACCTCGAGTCTCGGCCCACGAGCGAGC
AGCGCCCCCACCATTGAAGTCCCACCAACACCAACCTTCGTCATCAAAAT
CCCCAATCGACTACGAAAAACCCCTCCCAAACTTAACAGAACCCTTCCTC
GCCCCCGACCTACCGCAAGCCTTGCCGCCGCCGCCCCCAAAAGATAAAAG
CCCACGGGCTCCTCCGTCCGCACCACCCCAACCACCGCCGAGGACCCAAC
CACCCGTAAACGAGCCCCTACCGGTGCCCAGAAGGCGGCGAACAACCGCA
TCGAAAGGCAACTGCAGAGGCTGTGGCGAAGCTATAGTCGGAAAATCCAT
CTCCTCCGCCGATGGGCGACTAACCGGTCGGTACCACAAAGCTTGCTTCG
TCTGCCGGGACTGCCACGAACCGTTCCAGTCCGCCGAATTCTACGTGTTG
AATAACTCACCATATTGCCATCGACACTACCACAAGCTGAACCATTCACT
GTGCCCGTCCTGCGATAGAGGGATCGAGGGGCCGTGTTTGGAGACGGAGA
TGAACGAGAGATTTCACCCGAATTGTTTCAGATGTTATGATTGCCGATGC
GAACTCAGCGGCGATTACTTCGACTTCAATGGACGACCCTACTGCGAACG
ACATGCC

Sequences in the Contig:

SY0AAA60YE14FM1 SY0AAB15YO10FM1 SY0AAC57YI03FM1
SY0AAC60YH24FM1 SY0AAD45YN11FM1