Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1738
Length(NT) : 1686
Best Gene Model Blast : Link to GSTUMT00003489001 E-value : 0.0
Numbers of ESTs : 29

Blast Results:

Nr Definition: delta-1-pyrroline-5-carboxylate dehydrogenase
Accession: ref|XP_964169.1| Score: 1641 E_value: 1e-180
KEGG Definition: hypothetical protein
Accession: ncr:NCU03076.1 Score: 1641 E_value: 0.0
KOG Definition:
Classification: [Amino acid transport and metabolism].
Kog Number: KOG2455 Score: 1698 E_value: 0.0
PFAM Definition: Aldedh, Aldehyde dehydrogenase family. This family of dehydrogenases act on aldehyde substrates. Members use NADP as a cofactor. The family includes the following members: The prototypical members are the aldehyde dehydrogenases EC:1.2.1.3. Succinate-semialdehyde dehydrogenase EC:1.2.1.16. Lactaldehyde dehydrogenase EC:1.2.1.22. Benzaldehyde dehydrogenase EC:1.2.1.28. Methylmalonate-semialdehyde dehydrogenase EC:1.2.1.27. Glyceraldehyde-3-phosphate dehydrogenase EC:1.2.1.9. Delta-1-pyrroline-5-carboxylate dehydrogenase EC: 1.5.1.12. Acetaldehyde dehydrogenase EC:1.2.1.10. Glutamate-5-semialdehyde dehydrogenase EC:1.2.1.41. This family also includes omega crystallin, an eye lens protein from squid and octopus that has little aldehyde dehydrogenase activity..
Pfam Number: pfam00171 Score: 843 E_value: 1e-90
Swissprot: Q9P8I0|PUT2_EMENI

Sequence:
>Contig1738
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCTCGGGTCAGATGAGGCAA
CTGCTTGGTCTCTCGTCTATATATACCGGTAGATGCCCCCTCAATTCGTC
ACAATGCTTCACTCCTCTTGGGCTATCAAGAGATTGATCACTGTTGCAAC
TACCCGTCTGCCGTCTATTAGGAAAGCAAACATGTCCTTCAAAATCCCAG
CTATCGACAACGAGCCCAATAAGCTCTATTCCACGAGTTCCTCCGAGCGT
AAGGCTCTCACAGAAGCCATCCAAGCCCTTCGTTCAAACGCCCCAGTTTC
TGTTCCACTCCGTATAAACGCAGAGTCTATCACTACACAGTCTACGGTCC
CTCAATTCATTCCTTCGTCACACGCCACTACGCTCGCTTCATGTTCGCAA
GCTTCCAAGGAACAAGTTACTACTGCCATTTCATCCGCCCTTGCAGCTAA
GCCTGCATGGGAGTCTGCACCATTTGCCGACCGTGCAGCGGTATTCCTGA
AGGCAGCAGAACTAATTGCTGGAAAATACCGACCTGCCATTATGGCTGCT
ACAATCCTTGGCCAGGGAAAGAATACATGGCAAGCCGAGATAGATGCTTC
TACTGAATTAGTAGACTTTCTGAGGTTCAACGTTTTATACGCTGAGGAAC
TCTACAAGCAACAGCCAGCGAAGAATTCGCCTGGTGTTTGGAACCGCGCC
GAGTACCGCCCATTGGAAGGGTTTGTCTATGCCATTTCACCATTCAACTT
CACAGCAATCGGCGGTAATCTACCCATTGTACCGGCTCTTCTTGGCAATG
TTGTTATCTGGAAGCCCTCCCCAGCTGCGATCTACAGCAACTACCTGATT
TACCAGATCCTACTCGAATCGGGCCTTCCCGGGAATGTTATTCAATTCGT
GCCTGGAGATGCAGAATCCGTAACCGATGCCGCCCTCTCACACAAGGAAT
TTGCTGCGCTTCACTACACTGGCTCCACCGCTGTTTTCCGTGCACTCTAC
GGCAAGATCTCCCAGGGTGTGGTCGAGGCTAGATTCCGCTCCTATCCCCG
TATTGTGGGCGAGACAGGTGGAAAGAACTTTCACCTCGTTCATTCGTCAG
CCGATATTCGCAACGCAGTAATACAAACCATACGTGGTGCATTTGAATAT
CAAGGGCAAAAATGCTCAGCTTGCTCACGTCTCTATATCCCAAGGTCTAT
TTCTGAAGACTTCCTATCCCAACTGAAGGCGGAGACTTCTGAGCTCAAAG
TCGGTGCTCCAGACGAATCGTTTGAGAACTTTATTGGGCCGGTTATTCAC
AGGGGATCTTTCGATAAACTCAAGGGTGTGATTGACTCTGCCAAGTCGGA
TTCATCTCTTAAGCTTCTGGTTGGTGGGAAATATGATGACAGCAAAGGAT
TCTTCATCCACCCCACAATCTACGTCGCCAACTCCCCTGACCACAAAATT
TTCAACAATGAGCTCTTTGGCCCGATCTTGGCTGTATACGTTTACCCCGA
TGAGGACTTTGAGGGTGTTATGAAGACCATTGACGGGAGTGGCGGCGGAT
ATGCACTTACCGGCAGTGTGTTTGCCAAGGATAGGATGGTTATTAGAAAG
GCTGAGGATGCGCTCAGAAACTCCGCCGGCAACTTCTATATCAATGCAAA
GTGCACAGGTGCTGTTGTCGGCCAACAGCCATTTGG

Sequences in the Contig:

SY0AAA28YE21FM1 SY0AAA29YE21FM1 SY0AAA34YM19FM1
SY0AAA3YP04FM1 SY0AAA60YE07FM1 SY0AAB11YP12FM1
SY0AAB40YG02FM1 SY0AAB43YP08FM1 SY0AAB54YB14FM1
SY0AAC11YB07FM1 SY0AAC1YO06FM1 SY0AAC32YK24FM1
SY0AAC37YC24FM1 SY0AAC40YE17FM1 SY0AAC42YA15FM1
SY0AAC43YO23FM1 SY0AAC46YO07FM1 SY0AAC47YK08FM1
SY0AAC56YF07FM1 SY0AAC9YI08FM1 SY0AAD12YN22FM1
SY0AAD24YM18FM1 SY0AAD28YD22FM1 SY0AAD29YK20FM1
SY0AAD33YL21FM1 SY0AAD38YL10FM1 SY0AAD41YF06FM1
SY0AAD52YF03FM1 SY0AAD55YO02FM1