Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1737
Length(NT) : 631
Best Gene Model Blast : Link to GSTUMT00007241001 E-value : 4e-66
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein CIMG_04579
Accession: ref|XP_001245138.1| Score: 323 E_value: 2e-28
KEGG Definition: hypothetical protein
Accession: fgr:FG02719.1 Score: 312 E_value: 2e-27
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1737
TTGGGAGATCGCAAAGACCTTTCCAACCAGGACTGAAGGTAGTGTAAAGA
AGCACTGGTATAAGGATATGCATTATGCAGAGTTTGGCGAAGATGAGGTG
AGTGAGGCGCCAACGCCCATTTCTCTAGAAGGAATAAATAGCGCTGCCTT
GCTTGCTGCCATCAAAGAATATGAAGCAAACAAGTGGAAGGTCATCGGAA
CTAAAGTTGGGAAGCCGGCAAAGGCCTGCGAGCAGTATGCAAAAGAGCAT
TTTGCCGGGAAGTAAAGGGTTTAGCATCGGGGTTGAGATCGGTTGGGAAC
ATGGTGTCGGCGCATATTGAAGGGCTTTCTTTGTTTCTTTGCTTTATCCC
TCATTTTTTCCCCCTTCGATTGCTTTCCTCTGTTTGTTTGGTCAGATTGG
TGGTAAACGAGTGTCGTTCGTCTTTTGGTTTTTGATTCCGTTTCATCCAA
AAATCATTTCGATGTAGTCTTCCGTGGATGTGAAGAGAAGCGAGTCTTGA
CTATTTCCCCCCTCTCCCTCTCCCTCTTCCTTTCTCCTAAATACCTATCA
TATTTTCCAACGTCCCATCATCATCATCATCATCATCATCATCATACCTT
TTTCATTCATTCATTTTTTTTCTTTTTCTTT

Sequences in the Contig:

SY0AAA60YD15FM1 SY0AAB58YF01FM1