Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1736
Length(NT) : 711
Best Gene Model Blast : Link to GSTUMT00005077001 E-value : 1e-139
Numbers of ESTs : 2

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1736
TTGGTCTTCACATTGACATGGTGCGGGTACGAGTAGACTACTGGCATGCA
TCAAATTGGTTTCCGTTCTTTGCACCGCACGGATTCTGAGCCTCCGAGAG
TTTAAACCACTCGGGTAGATGGGGATGGTAAAGCTGCCCGGATAGGGCAG
GCTGGGTAAGTACTGTACAATCTTGAGGGCTGACCCACGTGATCTCGAAG
AACAGCGAATGTTACGATACACGGTTGCTTGGGCTGACCGGGTGGTGGCT
TCCTGCGAACTTCTCCCATAAGTATGCTGTGGCAACCCATGTCCTGAGAA
CACTGCAGGAGCACCGGAACCACCGACTACCCGTATAGCACAGTGTTAGC
ATTGCACTCTTGGCCTGTCGGACTGGGTCGCAGCACCAACGGCACTCGAG
CACCGTGCAGTACCACAATACCCCGCTCGTGTCCACATCTTGATCCATCA
CCCTATCTCATCATGGTGGGAATACTTGATCTACCGAATGAGTTAATCCT
TCACATCTCGACATATCAATCTCCGCCAGATATTAACTCCCTTATGAGGA
CGTGCCGTCATCTTGCGGGCCCTTTGGCCTACGGCCTTCTGGACAACGTG
TGTCGCTCGCGCTCTAGCGAGTATGGCAAACGAGCACTTTACTCTGCCAC
AAGCTGTCAGAACGATACCGTAATCAAGTGGCTCCTGGGTAGAAAGGTTT
TCGAGTTTGCC

Sequences in the Contig:

SY0AAA60YD07FM1 SY0AAC54YK03FM1