Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1735
Length(NT) : 827
Best Gene Model Blast : Link to GSTUMT00012181001 E-value : 1e-174
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein SNOG_07573
Accession: ref|XP_001797907.1| Score: 132 E_value: 4e-06
KEGG Definition: No Hit Found
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG3138 Score: 148 E_value: 1e-10
PFAM Definition: No Hit Found

Sequence:
>Contig1735
TTGGAAAAGAGAACGAGGGAAAAATGGGGCAGGGGTTTTTGTTCGTCATG
CACGGGGCGGTGGGTTAGAGATGGTTGGGTTGGGGGTTGCAATTGAGAGA
GGGGGGATAAACACCCTATGATCTCCGGGTCACGTGTTGCCCCGCATTCT
TTCCGGGGGGGGATTCGCGAAGTTCGGTATCGTGCAACGCGAATAAGTAT
GATACGATACTACGCTGAGGAAGTATCACAACTTAATGGTCGATACGACA
AAAAAAACAAAACAAAACACAGGGCAGGACGGACACGATCTTTTCATCCG
AAGAACGGTAACAAACTGCACCACTAGCCACCATTTCATTTCTCGCAACG
CTGCGATCAGCACCAAATAAATAAAATATCATACCTTCCACCTCTATCCA
ACTCCACCACTACCACCACTACCACCACCACCACGTCCAACCGCTAGCAG
ATGCCACAACCCTCCCACACCCCCCACCCAAACATAACAATAGCCCCGCC
AACACCCCTAACCATCCCACTGCTGAAACGGCTAAACACCCTCCTCCTAC
CGATCCCGTATCCGCAAACCTTCTACAGCGAGATCCTCCCTTCCCCCCTC
CTAACGCGTCTGACCCGTCTGGCATTCTACAACCCCCCGCCATCCTCCTC
CCCCTCCGCACAACCGATATGCATCGGCGCCATCCGCTGCAGATTGGAAC
CCCATGGCAAACTTTACGTGATGACGCTCTGCACCCTGAGCCCGTATCGT
GGGCTCGGCGTGGCGGGGAGGCTGCTGGAGGCGGTAGTGGGGAGCGGGGT
CAGAGAAGTTTACGCACACGTTTGGGA

Sequences in the Contig:

SY0AAA33YF13FM1 SY0AAA60YA20FM1