Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1734
Length(NT) : 793
Best Gene Model Blast : Link to GSTUMT00004492001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein SNOG_02248
Accession: ref|XP_001792863.1| Score: 239 E_value: 2e-18
KEGG Definition: hypothetical protein
Accession: ani:AN0852.2 Score: 229 E_value: 1e-17
KOG Definition:
Classification: [Signal transduction mechanisms].
Kog Number: KOG4293 Score: 153 E_value: 3e-11
PFAM Definition: No Hit Found

Sequence:
>Contig1734
TTGGGTGGAAGTAGTACTAGCTTTTCGCCGCCGATGACGAAGGGTGATAA
GGTTCTTATTGCGCATGGTGTCATAATGGGCGTAGTCTTCATCCTCCTCT
TCCCCTTCGGCGCGGCGCTGGTGCGCCTTCTAAACAACCGCATACCAAAC
GCCTTCGCCCTCCACCGCGGCTTACAAATTCTAAACTTCATGCTCGCAGT
GGTGGGCATGGGAATGGGCATTTGGCGGAGCAAGATATCCAATTCTCACT
ACAAATTTTTCCACCAGTACTTCGGAACTATCATAATTGCCCTCCTGCTC
GTGCAAGCCATGCTCGGCCAGCTCCACCACAACGTCTACCTCAAGACGCA
GAAGCGGAGCTTGTGGAGTTACGCTCACATCTGGCACGGACGCTTCGTCA
TTGTCGCTGGCATAGTCAATGGCGGGATCGGATTGTCGCTGCCAAGGACT
GATGCTCCTCAGAGTGCTGTGGTGGCGTATTCGGTGGTGGCGGGTGTGGT
CGGTGTGGGATATTTGGTGTTTTATTTCTTGAAGGAGAGGAGGAAGGAGG
TTGGCGTTTCTCCTTGATTTTTTTCTCTTTTTTGGCTTTCCCGAATTTGT
GTTTGCGCTTGGGATGAGGTGGAAGGGATATAGTTGTGGTTAGTATGATG
GTCTTTGTTTCTTGTGTTATATGGGTTTCGCAATTGGCGATGGTGGATTC
GATATGATATCCTTTTCCTTTTCCTTTCCTTTTTCCTTTTTCCTTTTTCC
TTTTTTTTTTTTTTTCATTAAGCCCCTCCCTCTCCTCCCCTCC

Sequences in the Contig:

SY0AAA60YA17FM1 SY0AAB25YM23FM1 SY0AAB8YO02FM1