Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1733
Length(NT) : 644
Best Gene Model Blast : Link to GSTUMT00004475001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein BC1G_00915
Accession: ref|XP_001560887.1| Score: 688 E_value: 9e-71
KEGG Definition: hypothetical protein [EC:4.2.1.17]; K01692 enoyl-CoA hydratase
Accession: mgr:MGG_12868 Score: 679 E_value: 5e-70
KOG Definition:
Classification: [Lipid transport and metabolism].
Kog Number: KOG1680 Score: 556 E_value: 5e-58
PFAM Definition: ECH, Enoyl-CoA hydratase/isomerase family. This family contains a diverse set of enzymes including: Enoyl-CoA hydratase. Napthoate synthase. Carnitate racemase. 3-hydoxybutyryl-CoA dehydratase. Dodecanoyl-CoA delta-isomerase..
Pfam Number: pfam00378 Score: 522 E_value: 4e-54
Swissprot: Q58DM8|ECHM_BOVIN
Gene Ontology:
GO:0005759 = Cellular component: mitochondrial matrix
GO:0004300 = Molecular function: enoyl-CoA hydratase activity

Sequence:
>Contig1733
TTGGCCCACAATATGTTTGCTCGTTTCATTCGACCTACCCCCGCCCGCCT
TATTTCTCCTATAGTCCCTCGTCTTGTCCATCCAATGTCTTCCCTAAGCT
CTAAATCTTACGAACACATTCTGGTTTCTTCCCCCAGGCCGGGTGTAGGG
CAGGTTACTCTCAACCGCCCAAAAGTCAATGCCTTGAACACTCCTCTTAT
GTCCGAGCTTAACGATGCTCTTCGCGCATTCGATGACTCAAAGGCAATCG
GTGCAATTATCATTACCGGCAGCGAAAGGGCTTTCGCTGCGGGCGCCGAT
ATCAAGGAAATGCAGAACTTGACATTCTCGGAAGCGTACAGTAAAGACTT
TATCAGGCTGTGGTCGGACGTCACGCAAATATCGAAACCCGTCATCGCTG
CTGTCAATGGGCACGCTCTTGGAGGCGGTTGCGAACTCGCCATGATGGCC
GACATCATCTATTGTGGACCAACGGCTACATTCGGCCAACCGGAAATCAC
ATTGGGAGTTATCCCGGGCGCAGGAGGATCCCAGCGGCTAGTTAGAGCTA
TCGGGAAAGCGAGGGCTATGGAATTAATTCTCACTGGAAAGACGTTCTCT
GCTGAGGAAGCGGAGAGATGGGGCCTTGTGGCGAGGGTGTTTGA

Sequences in the Contig:

SY0AAA60YA11FM1 SY0AAC18YK16FM1