Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1732
Length(NT) : 936
Best Gene Model Blast : Link to GSTUMT00001136001 E-value : 0.0
Numbers of ESTs : 8

Blast Results:

Nr Definition: hypothetical protein CHGG_09550
Accession: ref|XP_001227477.1| Score: 595 E_value: 1e-59
KEGG Definition: hypothetical protein [EC:3.3.2.9]; K01253 microsomal epoxide hydrolase
Accession: mgr:MGG_02509 Score: 536 E_value: 4e-53
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG2565 Score: 452 E_value: 1e-45
PFAM Definition: EHN, Epoxide hydrolase N terminus. This family represents the N-terminal region of the eukaryotic epoxide hydrolase protein. Epoxide hydrolases (EC:3.3.2.3) comprise a group of functionally related enzymes that catalyse the addition of water to oxirane compounds (epoxides), thereby usually generating vicinal trans-diols. EHs have been found in all types of living organisms, including mammals, invertebrates, plants, fungi and bacteria. In animals, the major interest in EH is directed towards their detoxification capacity for epoxides since they are important safeguards against the cytotoxic and genotoxic potential of oxirane derivatives that are often reactive electrophiles because of the high tension of the three-membered ring system and the strong polarisation of the C--O bonds. This is of significant relevance because epoxides are frequent intermediary metabolites which arise during the biotransformation of foreign compounds. This family is often found in conjunction with pfam00561..
Pfam Number: pfam06441 Score: 265 E_value: 5e-24
Swissprot: Q8MZR6|HYEP1_CTEFE
Gene Ontology:
GO:0033961 = Molecular function: cis-stilbene-oxide hydrolase activity

Sequence:
>Contig1732
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCGATCACGGCCCCGCAAAC
GGCCCCATCAGCCACGACCTTGTTAATCCACCAGAAGATCGTCCCAAACA
TGTCGGATACGCCGTCTCAAGAGCGGGGCGAGTCCTTCGACTCTCCTCAA
TCTTATAAGATCCACGTCGCGTCCAAATATCTCGACTTGACTACCCAAAA
GTTCGACACAGCCCGTCTACCGAATGACTTTGGACAACCTGAGGGTGAAG
AATGGGCCGATGGGACGCCCAAGCGGGTTATCGAAGAGCTGATTGACCAT
TGGCAGGAACGCTTCGACTGGCGTAAGCAGGAAGCCCAACTGAACCGGTT
ACCGAACTTTAGAGTTCCTATTGAAGTCGACGGGTTCGGGACGCTCCGCA
TTCATTTCCTATGGCGGAGGAGTTTGAGGCCGGATGCCATTCCGGTAATC
ATGGTGCATGGGTGGCCGGGCAGCTTCTGGGAGTTTTCGAAAATGATTGA
ACCATTGGCCAATCCACCGGATATGGGTATGCCGGCGTTTAATGTCGTTG
TTCCTTCCCTGCCCGGTTACGCCTTCTCCGACGGTCCCAAAAAACCCGGC
TTCGGGGCGAAAAAGATGGCCGAAGCCATGGACAAACTCATGAAGAAGCT
CGGATATGAACACTACGTCGCTCAAGGTGGAGACTGGGGCTGCCTAATCT
GCCGTTTCCTCGCCCTCCAATACCCCCAAAATGTCCGGGCAATCCATGTC
AACTTTCTCCATGTGAAGCCGCCGACATTGTTCTCCCACCCGGTAAAGTG
CCTAAAGCTTTCTCTGGCGATGGCCTCCAACGGAAGGTTCCCAGGGGCGT
ACACTCCCGAGGAAGTTGCTGGCTGGAAGAGGACAAAGAAGTTCTACACT
GAAGAGATAGGGTATCAGGCCATTCACGGGACGAAG

Sequences in the Contig:

SY0AAA45YI03FM1 SY0AAA60YA03FM1 SY0AAB42YK14FM1
SY0AAC19YM12FM1 SY0AAC27YN20FM1 SY0AAC41YD14FM1
SY0AAD34YE10FM1 SY0AAD4YM01FM1