Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1730
Length(NT) : 793
Best Gene Model Blast : Link to GSTUMT00009132001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: hypothetical protein SS1G_11436
Accession: ref|XP_001587444.1| Score: 660 E_value: 2e-67
KEGG Definition: hypothetical protein
Accession: fgr:FG06705.1 Score: 618 E_value: 9e-63
KOG Definition:
Classification: [RNA processing and modification].
Kog Number: KOG0816 Score: 641 E_value: 1e-67
PFAM Definition: No Hit Found
Swissprot: Q7S302|MRT4_NEUCR

Sequence:
>Contig1730
TTGGCACCAAAAGACACCAATTCCACAACCAACCTTTTGAAAAAAAGAAG
AGCATATTATCAGGACAAGATGCCCCGCAGCAAACGCTCAAAAGTCGTCT
CCCTAACAAAAACAGACAAGCGCCCCGGCAGGGAAAACAACGAACGTCTG
TACGGGAAAATCCGTGAGAGCATTGACGAGCACCAGATCGTATTTGTCTT
CTCGGTAGACAACATGCGGAACACCCATCTCAAGGAAGTCCGCACGGACT
TTAGCGATTCTAGAATATTCTTTGGCAAAACAAAAGTAATGGCCAAGGCT
CTTGGCACCTCCGCATCCGACGAATACCGGCTCAACCTGAGCTCGCTAAG
CAAGCACCTAACCGGCAATGTCGGGCTGCTGATAACCTCGCGCCCAGCGG
AGGAGGTACTCACCTACTTCGAGAGCTTCAGCAAGCAAGACTATGCACGC
ATGAACGCCGTCTCGCCCATCACGTTCATTGTCCCCGCCGGAGTCGTGTA
CTCTTCTGGTGGGAGCCTGCAGCAGGAGGAGGACGTACCCATGGCACACT
CGCTCGAGACTACCGTCAGGGGGCTCGGCATGCCGACTCGGTTGGTGAAT
GGCAAGGTCCACCTTGACCAGGAGTTTGTGGTGTGCAAGGAGGGGAAGAA
GTTGGATTCCAAGCAGGCTACGCTACTGAAGATTTTTGGGATCCCCACAG
CCGAATTTGTGATTCGGCCTAGCGCTTATTGGACGTCGGCTACCATGCAG
GTTACGGCTGTTGGTGCTATGGAGGAGTAAGCTGTGCCGGTAT

Sequences in the Contig:

SY0AAA2YL04FM1 SY0AAA5YP18FM1 SY0AAA63YM20FM1
SY0AAD32YJ03FM1 SY0AAD4YH22FM1