Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig173
Length(NT) : 1549
Best Gene Model Blast : Link to GSTUMT00007389001 E-value : 0.0
Numbers of ESTs : 6

Blast Results:

Nr Definition: hypothetical protein SS1G_12409
Accession: ref|XP_001586425.1| Score: 357 E_value: 3e-41
KEGG Definition: uncharacterized conserved protein
Accession: aor:AO090701000277 Score: 310 E_value: 8e-37
KOG Definition:
Classification: [Function unknown].
Kog Number: KOG2922 Score: 161 E_value: 1e-11
PFAM Definition: DUF803, Protein of unknown function (DUF803). This family consists of several eukaryotic proteins of unknown function..
Pfam Number: pfam05653 Score: 145 E_value: 7e-10
Swissprot: Q8BZF2|ICHN_MOUSE

Sequence:
>Contig173
GCACTTCCCTAGCTGGCCAAGGAGGAAAGACAAACGATGCAAGGGGGGTA
TCAACCTAGATGGGTGGGAGCGTGGATAGAGCGCTTCCCTTTGCGCCCTT
TCAGCGGAAGTATCCCAACCAGCAATCCCAACAGCTAGACTCCCCTCATC
CAAAAAGGGTGGCGTCGGGGTCACAATGCCCCTGTCCGTCGACCCGCCAC
TGCTTAACGAAGACCGGCTCATTTGCCAACCCACCCAAAGACTCTTCCTC
CCCATCCTCCTCCGGATCGGCATCCCCAACGCCAGCCCCCCCCCAGGCGC
CGCCACATAAGCATACTTGTCATTCGATCCCCTACGTATTTCAGTTCCAA
TTTCCGCCCAAAAGCTCTGATTGCGTCGGTCTCGTCGAGGCGCTAGGTCG
ATGTTCCGATTGAACACGGGAGAGGCGCCACGGAGATAGACTTGTGTTTG
CTTGTGCTAGCGCAGGTTCCTGGTTGATTGTGCTGGAAGAGCGGATTTGC
TGGGATGGCGAGGGAAGGGCGGAAGTGCTGGGTGTTGTATTGGAAGAGTC
AAAGACAGAGGGGGGGTCGAATTGGAATGCGAGAGCGGGTGGGTGCGGGT
GGGATCGTGGGGGTCTTATGATGGTGCGGGTGGTGATGCGGAACAGATCC
CTCACCCCCTAACTGAAGGTTTGGAATATCACCTCGCTGACTTGTGTTTA
TGTTACTACCTCTCTGGGAGTACTATCCCTCGAGGATTGAGTTGTGGTGG
TTGTATGATAGCAGCGACGCTCAAAGGGGAGGGGTTCATGAGGGATTCTG
TGCATTCGACCAACTCTGGACTGCCGGGGTTCGCCGACTTTTCCATGGAC
CCCGGGGACAACGACGAGTCCTCGCCAGATGAAGCATCATTACTCCTCCC
CCGCAGTTCACACTCCACCGCTTCCGAAGAAGACGGCGATGAAGTGGTAC
ACCCCCCGGACCATCGATACCTCTCATCACCGTACTGGTGGCTCGGCCTT
GTCCTCATGTCAATCGGGGAATACGGCAACTTTCTCGCCTACAGCACTCG
CGATGCTCAAAGAGCCATTCCGCGGCCGAGATCTCCTCGGCGTTGTGGTC
AGTATTTGCGGCGCTGGGATTGTGGTCTGGAGTGCCGAAAAGGAAGAAGT
CAAGCTTGGATCTCATCAGATCCTTGAGGCCATCACGCAGACTACTTTTG
AGGTTTACTTTGGGATTACGTGCAGCCTTATTGCCCTGTTGATGTATATT
TCCCCAAAGCGTGGAAGAAAGTACACATTCATTGATTTGGGGCTTGTGGG
ATTATTCGGCAGCTATACTATCCTCTCAACAAAAGGAATATCATCCCTCC
TCTCCTCATCCTTCTACCAAATCTTCACCTTCCCGATAGCGTACCCCCTC
GCTATAATCCTGGGATCAGCGATATTATATAGACTTTGAAACTGTCGACG
TGGGGGGATGCTGAAATTTGTTTCTGGATGTTTGCTGACGTTTTACGGTG
TGTGGATAACTTACCCCGGCCGCGGCAAGGCCAAGAACCCAGATGACGA

Sequences in the Contig:

SY0AAA16YF06FM1 SY0AAC14YL15FM1 SY0AAC37YM12FM1
SY0AAD21YH13FM1 SY0AAD46YJ17FM1 SY0AAD47YA02FM1