Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1729
Length(NT) : 3470
Best Gene Model Blast : Link to GSTUMT00001624001 E-value : 0.0
Numbers of ESTs : 20

Blast Results:

Nr Definition: hypothetical protein SS1G_01608
Accession: ref|XP_001597414.1| Score: 2752 E_value: 0.0
KEGG Definition: dynamin-like GTPase Dnm1, putative [EC:3.6.5.5]; K01528 dynamin GTPase
Accession: afm:AFUA_8G02840 Score: 2670 E_value: 0.0
KOG Definition:
Classification: [Intracellular trafficking, secretion, and vesicular transport, General function prediction only].
Kog Number: KOG0446 Score: 1493 E_value: 1e-166
PFAM Definition: Dynamin_M, Dynamin central region. This region lies between the GTPase domain, see pfam00350, and the pleckstrin homology (PH) domain, see pfam00169..
Pfam Number: pfam01031 Score: 954 E_value: 1e-103
Swissprot: P54861|DNM1_YEAST
Gene Ontology:
GO:0005741 = Cellular component: mitochondrial outer membrane
GO:0003924 = Molecular function: GTPase activity
GO:0042803 = Molecular function: protein homodimerization activity
GO:0000266 = Biological process: mitochondrial fission
GO:0000001 = Biological process: mitochondrion inheritance
GO:0051260 = Biological process: protein homooligomerization

Sequence:
>Contig1729
TTGGAGCGGGACAACTTTGACTACTTGTCATAAAAAGTTCTTCCTCAACT
AGGACCGTGAGTTGCACGCCTACGGTATCCTGAGTCGTTCGCTTGAGGAC
CCGCGTGTGCGAGCTTAATTGAACCTCTGCATTCTCAGAACTCCTGCGGT
TGTGGTTGGCTACAGCACGCCAGCAATCATTGGCTGCTTCGTTGTTTTGC
ACTTCCTCACACCCCCAAGTTTCTCTCCAGTGGATTCCTATTGCTCTGCG
ATACTGTACTCACTACTCATCAATTCGCCAGCACACAAACAACTCACCTT
CCCCGCTCACCTTTCACTGGAACCCTCACGAGGCTTTTTGCCCCGCAGGA
AGCTCGCCTCTTCTTTTTATCTTCTCTATCGCTCTCTCTTTTCCCCCACT
TGCTCTCACGATGGCTTGTCTCGGCGAAGATTTGCTCGGTGTAGTGAATA
AGCTGCAGGATCTTGTCTTTAATACTATTGGATCCGATTCTGGCTTAGAT
TTACCTCAAATCGTAGTTGTCGGCTCTCAATCTAGCGGGAAATCCTCGGT
GCTCGAAAACATCGTTGGTCGTGATTTTCTCCCACGTGGCTCAGGCATTG
TCACTCGTCGCCCGCTCATTCTTCAACTCATCAACATCCCCAACGATGAA
GGAAGCAGTGCGGAACCGCACACCCGGGAGGGCAACTCCGACCAGCCCGA
GTTTGGAGAGTTTCTGCATCAGCCTGGCAGACGGTACTATGATTTCAGCG
AAATCAAGAGGGAAATAGAGGCAGAAACATCTCGGATTGCCGGTAACAAC
AAGGGTATCAATAGGGCTCCTATTAACCTGAAAATCTACTCTCCTCATGT
TCTTAGTTTGACATTGGTGGACTTGCCGGGTTTGACAAAGGTTCCAATTG
GAGACCAACCAACAGATATCGAGAAGCAAACGAGGAATCTGATAACCGAG
TACATCGCCAAGCCCAACAGTATCATCCTTGCTGTTTCCCCGGCAAATGT
TGATCTCGTGAATTCTGAAGCTTTGAAGCTTGCCCGCCAAGTTGACCCAC
AAGGCAAGCGGACAATCGGCGTTCTCACCAAGTTGGACTTGATGGATCAT
GGCACCAACGCTCTCGAGATTCTCTCTGGAAGAGTTTACCCATTGAAGCT
TGGATTTATCGGAGTGGTCAATCGATCGCAACAGGATATCCAAGGGAACA
AGTCTCTTTCTGAGGCTCTCAAGGCCGAGCAGGAGTTTTTCAAATTTCAT
CCGGCTTACCGCAATATGGCACATAGATGCGGCACCCAATTCCTAGCAAA
AAGCTTGAATAGTACATTGATGCAACACATCAGGGATCGGCTACCTGACA
TCAAAGCTAGACTTAATACCCTTATGGGCCAGACCCAACAAGAGCTTGCG
TCTTATGGGGATATGCATTTTAGTGGTAAAGAACATAGAGGCTCCTTAAT
TCTACAGCTCATGACACGATTCGCCAGCTCATTTATTTCATCTATTGATG
GTACTTCATCCGAAATCTCCACTAAGGAACTGTGTGGTGGTGCACGGATA
TACTACATCTTTAACAGTGTTTTCGGCAACTCACTCGAGCTAATTGATCC
CACCACCAACCTTTCGGTCCTCGACATCCGAACAGCCATCAGAAACTCCA
CCGGACCAAGGCCCAGCTTATTTGTTCCGGAGTTGGCTTTCGATTTGCTT
GTCAAGCCGCAGATAAGATTATTGGAGATTCCATCCCACCGATGTGTCGA
GTTAGTTTACGAAGAGCTCATCAAGATTTGCCATACTTGTGGGAGCACGG
AACTTTCAAGATTCCCCAGGCTGCAGGCCAAGTTGATCGAGGTAGTGAGT
GACTTGTTGAGGGAGCGGCTAGGACCTACATCGACATATGTCGAGAGTTT
GATCGCAATACAACGAGCCTATATCAACACTAACCATCCCAACTTCCTTG
GTGCAGCATCGGCTATGTCATCCGTCATCCAAAATAAACAGGAGAAGGAG
CGTAAGGCTCAGGCATTCGAGAGAAGGAAGGAGCGTGATAGGCGCAAGCC
CACAAGTATGAGCAACTCCTCTGTACCCCCAATGCTTAATGGTGAGGGTG
GGCCCGAGTATGAGGAGAATCCAATAATTGAACGTGCCCGGATGATGCAT
GGTCGTGGTGAGTCGAGATCGATTTCGCCTGCCCCTGGCTCATTGGAATC
CTCAGCTATTAGCTCTGCCATGAATATCAATGGGCGGCCAAGCAGTCCTC
AAGTGCACCCTTCATCGGGGTCAACGACCAACAAAACAACCGACTCTTTC
CTGAACTACTTCTTTGGGAAGGAGGGTAGTATGCCAGCAACCAGTGGAGC
TGCCCCAAGATCTGCACCTGAACCGAGTTTCACCCAGAGCATCAGGCGTG
GAATGGAAAGGAACGAGAAGCCTGCGTTCGACATGTCAAGGCTTTCACAG
AATTTCGATGATACTAGTCTAGAGCCAACTCCAACCTTCACCCCAACTCC
TGATGAGCCAGCCCTGACCGAGAGGGAACAGATGGAGACAGAGCTGATTC
GCCGACTCATCTCTTCCTACTTTAACATTGTCCGCGAGACAATTCAGGAT
CAAGTTCCCAAAGCAGTTATGCACTTCCTCGTCAATTTCAGTAAGGACGC
CGTCCAGAACAGGCTCGTGACAGAGCTGTACAAGGAGGAATTCTTCGGTG
ACCTCCTGTACGAGGATGACGCTATCAAGGCCGAGAGGGAGAAGTGCGAG
AGACTCCTGAAAACTTACCGCGAGGCATCTAAAATTATTGGAGAAGTGGG
TTTATAAGAAAAAAGAACAAAGAAACCGTGTTGAGTAAGGAGAAATATCT
AAGTTCCCTGAATAGAGCAAAATGAAACAAAAAAAATTGTTGGTTGTGTG
GGTCGGATCATAGGCTCCCGGTGGGGCGATGCCGAATGAGTCTGATGGAA
ATGATATGTATATAAAGGTTACGAACGAAATCATCGAGAGCGAAAACGAG
GATCACGATTTGATGACGAACCCTTTTTCTTTTCTTCTTTTCTTGCCTCC
AGCCTTTTGTTCTGATGGGGGTTTGAAGGTGCTCGGCACACCGGCGACGA
AAAAGGGAACGAGAAGAAAACCGCGTCCACGGGGGCAGGATGGCTTTCTA
TTATATTTTTTCCATATCTTACTATACTATATACTATACTATACTTGTCA
AGGGATCCGCGCTGGCCGGATTCGATAACGAGCCCTCTTCTTTTTCTTGT
TTTCTTTCTCTCCTATCTCCCGCGGCTTGTCCATGTCATTGTCCATGTGT
TTCTCTTTCTTCGTTGAGTATACATGTCTGTGGGAATTTGTTTGGTCTGT
TTTTCTTCATTTCTTTTGAGTAGCATTGTTAACTGCCTAGCATATACAGT
TTTCAAGTTTTTTGTTTTTGTGTTAGGTTTGGCGGCTCTCTTTCTAGTTG
AAACATTAGATTCTCCACTC

Sequences in the Contig:

SY0AAA12YO18FM1 SY0AAA44YF07FM1 SY0AAA45YM10FM1
SY0AAA55YO22FM1 SY0AAA5YO10FM1 SY0AAA7YI18FM1
SY0AAB38YM15FM1 SY0AAC36YD01FM1 SY0AAC3YI17FM1
SY0AAC54YM24FM1 SY0AAC55YO13FM3 SY0AAC56YP18FM1
SY0AAC60YL24FM1 SY0AAC61YM14FM1 SY0AAD11YA23FM1
SY0AAD11YJ05FM1 SY0AAD35YD06FM1 SY0AAD40YN05FM1
SY0AAD46YI21FM1 SY0AAD59YO15FM1