Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1728
Length(NT) : 927
Best Gene Model Blast : Link to GSTUMT00003085001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: hypothetical protein SNOG_11878
Accession: ref|XP_001802115.1| Score: 175 E_value: 5e-11
KEGG Definition: hypothetical protein
Accession: ncr:NCU00223.1 Score: 166 E_value: 3e-10
KOG Definition:
Classification: [Function unknown].
Kog Number: KOG4592 Score: 146 E_value: 3e-10
PFAM Definition: GAL11, Transcription regulatory protein GAL11. This family contains yeast GAL11 proteins. Gal11 and Sin4 proteins are yeast global transcription factors that regulate transcription of a variety of genes, both positively and negatively. Gal11, in a major part, functions in the activation of transcription, whereas Sin4 has an opposite role, yet they are reported to be present as a complex in the so-called RNA polymerase II holoenzyme..
Pfam Number: pfam05397 Score: 120 E_value: 3e-07

Sequence:
>Contig1728
TTGGAGCTTGTCTAGTTTGCAGCAATCATCACGGAATGCCGCGGATGAGG
TGCTTATGCTTCGTTACAAGAATTCCTTGTTGGAAAGGATACTGTTGGAG
AAGGGGATAAATGTCGCTGCCGAGTTGAAGGCCTTTGCCCAATATGACGA
CAGACCACAACCAGCCGCACCTCAGCCGATCCCGCGACCCATACCCTCTC
AAGCTCAACAGCAACAGGCGACCCTCCAACAACAACAGCATATGCATAGA
CCAATGATGGCACAACCCCAACAGCAGCAAAAACGACCATCTGTTAACCC
TCCGCCCGAGTCGCTATTCATCAAGACTAGTCCTATAATGCCGCCAAACT
CGCGCAATAATTCGCCGTCGATTGCTATCCCTACACCCCCGGATGCGTCC
GCGTACCAGATCCCGCAGAGTGTAGTCACGACACCTACGGCTCCTTCGGA
ATTTCAACACCCAGGGATTCCAATGCAGAATTTTTATCCCTCGCCTTACC
AGGCACATATGGAAGAGCTCGGCAAGCTACCCCGCAGCAGGAATATGACG
CCGAATTACTCGAGAGCACAGAAGACGACACTCAAAGCGGACTCGAAAAT
CAATCTGCAACGGCAGACGGGGTTGGCGGTGAAATGATTGGAGGAATGCT
GCGGGGGTCTCCATTACAGCAGCATGGGATTTACAGTAATAATAATTTTA
ACTCTCCTTTCGGTTTTACTGCAAATAATCTAAGATGACGTTGCTCTATC
CGTAGAAGTTGCACGAACTATCAGGGCTGGGGTTTCCTTCTATTGTGCTA
CATATTTTTTTATCGGCGTCACCCTTTTTGGTTTTTCTTTCTACGGTTTA
TCGGAAAAAAAAAAGTGATCTTTCGACCCTGCGCTTCTTTCTCCCTCTAG
TGTACCGGCATCTATATTGCTTTGCTT

Sequences in the Contig:

SY0AAA4YG06FM1 SY0AAA5YN08FM1 SY0AAB19YA16FM1
SY0AAB41YB15FM1 SY0AAD3YP23FM1