Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1727
Length(NT) : 703
Best Gene Model Blast : Link to GSTUMT00011246001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein SS1G_10000
Accession: ref|XP_001589365.1| Score: 511 E_value: 4e-50
KEGG Definition: hypothetical protein
Accession: ang:An02g05380 Score: 479 E_value: 9e-47
KOG Definition:
Classification: [Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG1302 Score: 470 E_value: 6e-48
PFAM Definition: Sec1, Sec1 family..
Pfam Number: pfam00995 Score: 217 E_value: 1e-18
Swissprot: Q63615|VP33A_RAT
Gene Ontology:
GO:0031902 = Cellular component: late endosome membrane
GO:0005765 = Cellular component: lysosomal membrane

Sequence:
>Contig1727
TTGGCCATTACACAGTCACATCCAACACTAAATGGCTCCCCACTCGACCA
CCATCGACACTGCCCACATCAAAGCCACCGCTCAAAGAGACCTTCTAGAC
CTTCTTGTTGCTGTACGCGGGAAGAAGACACTCATCCTAGATAAATCGTT
AAGCGGGCCTGTTGGCTTGTTTTGCAAGTTTTCTGCTTTGCAAGATCATG
GTGTCGACAAGATATTTTGGTTAGACGAGAATGTTGTTGCCGATCTCACG
CAGAAGAATATCGTATTCCTCGTACGGTGCACGGTCAAAAATGCCCTCAA
GATAGCTGCACATGTCAAGAATAACGCGAAAATTCCGGGCCAGCAATTCG
AATATAATGTCATGTTTGTTCCTCGGCGGACACTCGTTTGCGAGAAGATC
TTGGAAGACGAAGGTGTTCTAGGGGACTTGACGATCGGGGAGTTTCCGCT
TCACTTTATACCCCTTGAGTCAGACCTCCTCTCCTTGGAGCTTGAAGATG
CCTTCGAAGAACTATACCTCCGCAAGGATCACACATCCATCTTCTACTCT
GCTCGCGCACTTATGAACATACAACGTCGGTATGGGCTTTTTCCGCGAAT
AATTGGCAAGGGGGACTGTGCAAGACGCCTTGCAGATGCTCTGATACGAA
TGCGCGGCGAGGAGGACGCTTTAGATTCTAGTTCTAGCCCGTTCGCTTTA
GCG

Sequences in the Contig:

SY0AAA5YM24FM1 SY0AAB29YM06FM1 SY0AAB42YB23FM1