Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1726
Length(NT) : 746
Best Gene Model Blast : Link to GSTUMT00002465001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein SS1G_01978
Accession: ref|XP_001597782.1| Score: 711 E_value: 3e-73
KEGG Definition: aminopeptidase, putative [EC:3.4.11.7]; K01261 glutamyl aminopeptidase
Accession: afm:AFUA_5G04330 Score: 708 E_value: 3e-73
KOG Definition:
Classification: [Amino acid transport and metabolism, Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG1046 Score: 505 E_value: 5e-52
PFAM Definition: Peptidase_M1, Peptidase family M1. Members of this family are aminopeptidases. The members differ widely in specificity, hydrolysing acidic, basic or neutral N-terminal residues. This family includes leukotriene-A4 hydrolase, this enzyme also has an aminopeptidase activity..
Pfam Number: pfam01433 Score: 107 E_value: 8e-06
Swissprot: Q9USX1|APE1_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol

Sequence:
>Contig1726
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCGTTTGGGGCCAATTCGTT
ACTCAAGAATCCTTGCAAACAGCCTTCGCCCTTGACGGTCTTCGTGGATC
CCATCCTATTGAGGTGCCCGTGAAGAATGCTCTCGATATTGACCAGATCT
TTGACCATATCAGTTACCTCAAGGGATCCGGCACTATCCGTATGCTCAGC
AGCCACCTTGGCGTTGAGACCTTCTTATTGGGTGTTTCCAAATATCTAAA
AAGGCACGCCTATGGAAATGCCACAACTGTAGATTTGTGGGCTGCCCTTA
GTGAAGAGGCAAAGACAGACGTTGCTGCTTTTATGAGCAACTGGATTAAA
TCAATTGGTTTCCCTGTCCTCACAGTCACAGAAAAGCTTGGCCACATCAT
TGTCGAACAAAAGAGATTCCTAAGCACTGGGGATGTGAAGCCTGAGGAAG
ACCAGACAACTTGGTGGGTGCCGCTATTCTTGTCCGAGAAGTCCTTCACC
ACAGGATCAGAGAATACTACGGCTCTCATGTCCAAAGAAGCGACAATCAA
AGGAATTGATACCAATTGTTACAAGTTCAACAACAACCAGAACGGGTTCT
ACAGGGTAAATTACCCAGCAGAGCGACTTGTGAAGTTAGGGGAGATGAGA
AAGCAGCTCAGTGTAGCAGACAGAATTGGACTAATCGCTGATGCTGCTGC
AATGGCACTTTCTGGTCTTGGTTCCACTACAGGCCTGCTATCATTT

Sequences in the Contig:

SY0AAA5YM07FM1 SY0AAB37YO01FM1