Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1725
Length(NT) : 969
Best Gene Model Blast : Link to GSTUMT00005431001 E-value : 1e-146
Numbers of ESTs : 49

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Signal transduction mechanisms, Cytoskeleton].
Kog Number: KOG3671 Score: 117 E_value: 8e-07
PFAM Definition: Mucin, Mucin-like glycoprotein. This family of trypanosomal proteins resemble vertebrate mucins. The protein consists of three regions. The N and C terminii are conserved between all members of the family, whereas the central region is not well conserved and contains a large number of threonine residues which can be glycosylated. Indirect evidence suggested that these genes might encode the core protein of parasite mucins, glycoproteins that were proposed to be involved in the interaction with, and invasion of, mammalian host cells..
Pfam Number: pfam01456 Score: 112 E_value: 3e-06

Sequence:
>Contig1725
TTGGACCCTCCATCAAACCATCTTTGTTCCCATCACTCTCTCTACCTCTG
GGTGCTATTGTCTTCAAACCCTAGTCAGTCGCTACGAATCACCCTCCCGG
AACCCAAGCGCCTTCTCCCCGTTTCCTCTGACATACGCGTTTCGTCTGAA
GAGAGAACCGCCAAAAAATAAAATAAAATAAAAAAACAGCCCTTTTTAGG
CTTGGTGATTTCAAAAGAGCCCCACACCCAACCTCCTCTCGATTTCTTCA
TTCAGTGTTTGGACAGACTTCTCGCGAACACTCAAGGTTTACCAAGGGAA
AGACAAACAAATCTCTCCTCCCCCTCCACCCCCTCCCTCCCCTTGCCCAT
ACCTTCAATTGTCACTATCCATTACCATCTTATTTCTTCCCCTCTTCCTC
CTGATAAGAACTTTGTCTGTTCCTATCAATCTTCACAAGACGATGTCTCG
TCGTTCGCTTTCCCTCTTGAGTTCGTTGCTCTTTGTTCTGTTGCTCTTTA
CTCCCACCATCCTCGCGGACAGTGAGCAGCAGTTCCAAGAACTCGCAAGG
GACGTCCCGCAGGACAGACTCCATGCAGCCCTTCACGACTACAATGGGGC
TAAGTTCAAGCATGGTGTGTTCCCCGGCGACCGACCCGCTCTTGATGTCA
TCCACCGCGAACGGGCTGCTGATGCCACCCGTCTAGTCAAATTGGCGAAA
CGACAATCAAATACCACAACCACGAGCTCCCCCCCCAGCACCCCTCCCAC
TACCACTGCCCTCTCAGTCACTCCCACCTCTAGACCTTCGTCGGCTAGTC
CGACAACGCGTCCGCCGACAACCACCCCCGAGCCAGCCACTACAGCACCC
TCTGCCGCCCCCAAAAGAGGAACTACTTCCCTCACCTCAAGACTCACCAG
GACCGTCACTGGTCCCGATGGCGTAGCCACTTTCACGGATGTCACCGTTG
TTGTTGCTACGCCCACTGA

Sequences in the Contig:

SY0AAA11YO23FM1 SY0AAA13YP05FM1 SY0AAA14YG05FM1
SY0AAA15YK07FM1 SY0AAA1YP04FM1 SY0AAA25YO10FM1
SY0AAA26YN23FM1 SY0AAA27YA20FM1 SY0AAA27YO12FM1
SY0AAA2YN18FM1 SY0AAA31YN06FM1 SY0AAA33YF06FM1
SY0AAA35YA19FM1 SY0AAA38YA18FM1 SY0AAA38YB03FM1
SY0AAA42YP24FM1 SY0AAA43YO01FM1 SY0AAA43YO08FM1
SY0AAA44YF20FM1 SY0AAA48YF20FM1 SY0AAA48YH13FM1
SY0AAA50YF23FM1 SY0AAA50YJ08FM1 SY0AAA52YO13FM1
SY0AAA5YL22FM1 SY0AAA60YP24FM1 SY0AAA6YH07FM1
SY0AAA8YF22FM1 SY0AAA9YK15FM1 SY0AAB29YO17FM1
SY0AAB32YC01FM1 SY0AAB36YG06FM1 SY0AAB37YF16FM1
SY0AAB42YK03FM1 SY0AAB44YC17FM1 SY0AAB44YD16FM1
SY0AAB46YA07FM1 SY0AAB49YH04FM1 SY0AAB50YO10FM1
SY0AAB53YO02FM1 SY0AAB56YB24FM1 SY0AAB58YE01FM1
SY0AAB61YA03FM1 SY0AAB9YI24FM1 SY0AAB9YM12FM1
SY0AAC20YJ06FM1 SY0AAC48YL22FM1 SY0AAD24YF02FM1
SY0AAD42YC21FM1