Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1724
Length(NT) : 541
Best Gene Model Blast : Link to GSTUMT00000063001 E-value : 2e-61
Numbers of ESTs : 4

Blast Results:

Nr Definition: Vacuolar protein sorting 55 superfamily
Accession: ref|XP_001257685.1| Score: 370 E_value: 4e-34
KEGG Definition: Vacuolar protein sorting 55 superfamily
Accession: afm:AFUA_6G04780 Score: 367 E_value: 5e-34
KOG Definition:
Classification: [Signal transduction mechanisms].
Kog Number: KOG2174 Score: 313 E_value: 6e-30
PFAM Definition: Vps55, Vacuolar protein sorting 55. Vps55 is involved in the secretion of the Golgi form of the soluble vacuolar carboxypeptidase Y, but not the trafficking of the membrane-bound vacuolar alkaline phosphatase. Both Vps55 and obesity receptor gene-related protein are important for functioning membrane trafficking to the vacuole/lysosome of eukaryotic cells..
Pfam Number: pfam04133 Score: 407 E_value: 8e-41
Swissprot: P47111|VPS55_YEAST
Gene Ontology:
GO:0005770 = Cellular component: late endosome
GO:0045324 = Biological process: late endosome to vacuole transport

Sequence:
>Contig1724
TTGGTCTCAACCCAAACTTTATCCTATCCAACCATATCCATGATAATATT
ATGATACCGTAGTCCACCCACCACACAAACCGACCCTAAAAAACCATGGC
GGGCCTAAAAACCATAATCGCCCTCTCATTCATCCTAGCGATCGGCTTCC
TCCTCGTAATCCTCTCGAGCGCCCTCTTCAACAATTACTTTCCACTCCTG
GTAGTGGCAAACTACCTCCTGACCCCGCTCCCGAACGCCATCTGTGCGCG
CGTCGCCTCCTCCTCATCCTCCATCTACTACTCCTCCCCCTGGGCGGATG
GCGACGGCGGCGGCGGCGGTGGAGTGATAGACCTGGGCAGGTTCTTGACG
GGTTTTTTGGTGGTTATGGGGATTGCATTGCCGGGCGTGTTGGCGCATTC
GGGTATTATTACGATTCCTGCTATGATCATGGCGGTTGTGGGTGGCTTGT
TGATTTATGGGACTATTATTTGCTTTGGCATGTTTTTTATCGAGGAGGAG
GAGGGGGGGGATGTGGGGTTTTAGGCGCGGGGGGGGGGGGG

Sequences in the Contig:

SY0AAA5YL18FM1 SY0AAB27YI07FM1 SY0AAB31YL10FM1
SY0AAB47YN20FM1