Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1723
Length(NT) : 650
Best Gene Model Blast : Link to GSTUMT00003824001 E-value : 1e-146
Numbers of ESTs : 6

Blast Results:

Nr Definition: hypothetical protein CIMG_08502
Accession: ref|XP_001241339.1| Score: 780 E_value: 2e-81
KEGG Definition: hypothetical protein
Accession: yli:YALI0E23386g Score: 719 E_value: 1e-74
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG3165 Score: 779 E_value: 6e-84
PFAM Definition: Fcf1, Fcf1. Fcf1 is a nucleolar protein involved in pre-rRNA processing. Depletion of yeast Fcf1 and Fcf2 leads to a decrease in synthesis of the 18S rRNA and results in a deficit in 40S ribosomal subunits..
Pfam Number: pfam04900 Score: 454 E_value: 3e-46
Swissprot: Q5RFQ0|FCF1_PONPY

Sequence:
>Contig1723
TTGGTTCAGTCTCCCCCACCATCACCACCATCACCACCACAAGAATTCTT
CAATTCACAACACAAACGCAATGGGAATCGCCAAGAAAACCCGCAAATTC
GCACAAGTCAAGCGAGTAATCTCCTCCCGCGACACCCGTCTCAAAAAGAA
CCAAGCAAAGCAACAAACCGCCATCACAAAAAAAGACAAATCCGGCGAAG
TAGTTCGTGAAATCCCACAAGTCTCCTCCTCTCTCTTCTTCCAATTCAAC
ACGGCGCTCCGACCACCTTACTCCGTCCTCGTGGACACCAACTTCCTGAA
CTTTACCATACAAAAGAAGTTGGAGGTGATGCAGTCCATGATGGATTGCC
TGTACGCGAAGGCCACGCCCGTCATCACGGATTGTGTCATGGCGGAATTG
GAAAAGTTGGGGAGTCGGTATCGGATCGCGTTGCGCATCGCTAGGGATCC
TAGGTTTGAGAGGGCCAGGTGCGATCATAAGGGGACGTATGCTGATGATT
GTATTGTGAATCGGGTTTTGCAACATAAGATATATATCGTCGCGACAAAC
GATCGGGATTTGAAGAGGAGGGTAAGGAAGATTCCCGGTGTGCCTATCAT
GAGTTGTGGGAATGGGAAGTATGTTATCGAGAGGTTACCGGATGCGCCGG

Sequences in the Contig:

SY0AAA5YK18FM1 SY0AAB2YL16FM1 SY0AAB41YF18FM1
SY0AAB44YE22FM1 SY0AAC27YI18FM1 SY0AAD36YI02FM1