Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1722
Length(NT) : 869
Best Gene Model Blast : Link to GSTUMT00000245001 E-value : 0.0
Numbers of ESTs : 40

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE63316.1| Score: 766 E_value: 1e-79
KEGG Definition: ubiquitin-protein ligase [EC:6.3.2.19]; K06689 ubiquitin-conjugating enzyme E2 D/E
Accession: aor:AO090020000073 Score: 766 E_value: 7e-80
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0417 Score: 697 E_value: 4e-74
PFAM Definition: UQ_con, Ubiquitin-conjugating enzyme. Proteins destined for proteasome-mediated degradation may be ubiquitinated. Ubiquitination follows conjugation of ubiquitin to a conserved cysteine residue of UBC homologues. TSG101 is one of several UBC homologues that lacks this active site cysteine..
Pfam Number: pfam00179 Score: 528 E_value: 1e-54
Swissprot: O74196|UBC1_COLGL
Gene Ontology:
GO:0004842 = Molecular function: ubiquitin-protein ligase activity

Sequence:
>Contig1722
TTGGCTGCTCCCCACCTTGGCTCAACTTCCACAACAACTCAACTCTCTCC
TGTTCTTACCTTTGTCAATCCTTCCCTATTCTTTACTTTACGCTTCACTC
CGTCACTCCTACAACCTTCAATAGCAATACTCCCATAACAACCAGTTCGA
AATGGCCCTCAAGAGAATTAACAAGGAACTCAGCGATCTCGGAAGAGATC
CACCCTCATCATGCAGTGCCGGTCCTATTGGCGAGGATTTGTTTCATTGG
CAAGCAACCATTATGGGTCCTGCAGATAGTCCTTACTCCTCTGGGGTATT
CTTTTTATCCATCGCTTTCCCCACCGACTACCCTTTCAAGCCTCCCAAGG
TCAACTTCACTACCCGTATCTACCACCCAAATATCAACGCCAACGGCAGT
ATCTGCTTGGATATCTTGAGAGACCAATGGTCGCCAGCTCTGACTATCTC
TAAGGTTCTGCTTTCCATCTGTTCAATGCTTACAGATCCGAACCCCGACG
ATCCCCTCGTCCCCGAGATTGCACACGTCTACAAGACCGATCGTGCCAGG
TATGAGGCTACGGCCAGAGAGTGGACCAGGAAGTATGCCATTTAGTGATG
GGTGTGGTATGGATTGTGGCGGACTCGGTGGGCGGGCATTCTTTAGTCTG
TTTTTTTTTTCCATTAGGGATGGTGCAAATTAAACAACTTTTTCTGATCC
TCGGTGGTGGAGCTCCATGTTTAACGGATGATAGGTGAGCTCAAACATTG
CGATTTGTAACGAAACAAACTTTGGCTAGTATGAAACTTGTGGTGTTTTA
TGGGGGATTAGTGATTCTGTAGCTGGCGTGTAGCCAAATTTGCAAATAAT
GCGAGAAACTGTTTATTAC

Sequences in the Contig:

SY0AAA1YO20FM1 SY0AAA33YJ10FM1 SY0AAA38YB18FM1
SY0AAA41YJ15FM1 SY0AAA44YC07FM1 SY0AAA44YK16FM1
SY0AAA46YE04FM1 SY0AAA46YN02FM1 SY0AAA56YG14FM1
SY0AAA5YK14FM1 SY0AAA62YJ18FM1 SY0AAB15YN22FM1
SY0AAB1YP18FM1 SY0AAB20YH09FM1 SY0AAB24YI12FM1
SY0AAB32YB10FM1 SY0AAB33YF20FM1 SY0AAB37YM17FM1
SY0AAB39YI22FM1 SY0AAB45YA03FM1 SY0AAB46YJ07FM1
SY0AAB50YA05FM1 SY0AAB50YK20FM1 SY0AAB51YM01FM1
SY0AAB53YM16FM1 SY0AAB53YM19FM1 SY0AAB59YO05FM1
SY0AAB5YG01FM1 SY0AAB9YK24FM1 SY0AAC31YL20FM1
SY0AAC50YD15FM1 SY0AAD14YO12FM1 SY0AAD34YA24FM1
SY0AAD38YE16FM1 SY0AAD3YJ15FM1 SY0AAD40YF15FM1
SY0AAD49YK06FM1 SY0AAD52YO01FM1 SY0AAD55YF09FM1
SY0AAD57YG18FM1