Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1721
Length(NT) : 837
Best Gene Model Blast : Link to GSTUMT00005219001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001218023.1| Score: 482 E_value: 1e-46
KEGG Definition: predicted protein
Accession: aor:AO090009000626 Score: 480 E_value: 9e-47
KOG Definition:
Classification: [Function unknown].
Kog Number: KOG4493 Score: 187 E_value: 5e-15
PFAM Definition: DUF1649, Protein of unknown function (DUF1649). This family is made up of sequences derived from hypothetical eukaryotic proteins of unknown function..
Pfam Number: pfam07855 Score: 299 E_value: 5e-28
Swissprot: O13978|MUG66_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus
GO:0030437 = Biological process: ascospore formation

Sequence:
>Contig1721
TTGGCACAAAGGGCCATACATAACGGTCAAGTCACGGCCAAAAAGAAGGG
GAAATAAAATCTGCACTTGCTTCGAGCTAGCCTTTCGAAAAAGGCGACGG
CAACCGCCGGCATCCAGACATCCACACGACCTTTGTTATCCTGTTTTTTC
TTTATTATACCCTTTCCCTTAGAGGGGCATATAACCCCCAGGACACGCTC
CTGCCCTCCAGGGCTGATTTCCTTCCAAACTTGAGTTCCCACTCCAAGAC
GATGGGATGGAACGGCCGCCCGTCTTCTCACTGGATGTCCTCGCCGATCG
CTCTTTGGTGAAGGATATTGTCAAAGGTGTCATCTCAACCGTCTTCTTTC
ACAGATTTTTCCCTACTGTCAGACCGAAAACCAGAGACCTACTCGATCTC
ACTTTGCCTGCAGTAGACGATCCTGAGCTCGATGAGCTTATCAACCAACG
CACAAATATTTTGATAGGATCGATAGAAGCCTCAGCAGGCGTTGGAACAA
AGCCCCAACGCGGGGAAGTAGTAGTGTACACAGTGGAGTTCTACGAGAGG
CGCCCAAAGAAGAATTGGTTCTCGAAAGCTGAGGAGAAAGTGTGCTGGGA
GCAGTGGGTGCTGAGTGTTACGGTTGTCTCTCCAAGGACCGATGCTGAGC
GTATCAAACTCCGAATGTCTATGGAGGCACAGCTACAGGCCGCTGTTCTC
AATATCATTACCATAGCCAGCATGAAGAAGGACCACATTCCGCCGATCAC
CACCAATGAGGCCAATCCGTTTCCCTATTCGATTACCGTCTCACCCAAGG
GCGAGACCTGGGGTGCCCGAATGGGGATATTCTCAAA

Sequences in the Contig:

SY0AAA5YK10FM1 SY0AAB4YJ06FM1 SY0AAD57YD03FM1