Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1720
Length(NT) : 1131
Best Gene Model Blast : Link to GSTUMT00006633001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: hypothetical protein AN7092.2
Accession: ref|XP_664696.1| Score: 206 E_value: 2e-14
KEGG Definition: hypothetical protein
Accession: ani:AN7092.2 Score: 206 E_value: 9e-15
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1720
TTGGCCTTCCGGTATGCCAGTGGATACAATACTCGAGGTGAACCCCCACC
CTCTCTGAGAACGAAATCCCACAGCACATGTAATTCAAATCTCGATTCGT
CCGACTCTTAACCAGCGCAACTCAAAAATTGATACAAACGATCCAGTCAA
ATGCCACCAGAGAAATACCTCAGCAACGCAGCAGTGGAATACATTGAAAC
CCGGGTGGATGGCAAGCTACATCCGGCTTTCGAGGACCCCAATACGGGAA
TAAGATACAACCCGACGATAGACCAATTTCTGGACCAGAAACGACTGGAA
TTGCAACAGCAGCGACAACAGCAGGAATTACAAGCCTCCATTCAACACCC
AACGTCCCTGGACAAGTTGGTCGAAGAGCGCAAGGAGAAATTCCAAGAAG
CGCTTGACGCATACCTCAAAACTCCCTCCGTGGAAAAGACTCCCAGCAAG
CTGGTGGGAAAGACGACATGGGACGATATCAAGGAGCTAATGCGCAAGGC
GGAAGATGAGTACCAGGACGTCGGCACCATTCGCAAACACTTGCGCAAAT
TCAGTGAGAACGCGCCGATATTCAATTCCTGGTTGACCCTGCTGCCGCAG
GCCTCCTACACCTCCACCATATACGGCGGTTTCAAGATCATGTTTGACGC
CGCCGGGAAGCTGCACGGTGTGCGCGAGAAGGTGTTCGAGATACTCGGCG
AGATCCCTGACAGGATTGCTAAGACACAGGTATACGCCGAGCTCTACCGG
TCTTCAAAGCAGGTACAGGAGAGGAGTGCGGAGTTGTATGTTGCGATTTT
GGGCATTTTTGAGCATGTGCTGGGCTGGTTTGCGAAGAAGCCAGAGAGGA
AATTCGGAAAGGCATTACTGAAAGGCGAACTCTATTCTAAGGAGATTGAC
GAAAAGGTTTCGAAGATGAGGGGTGTTGCGAAAAACCTGAGGGAAGAAGC
AAAGCTATGTTTGCACGAGAGTTTAAGGCAGGTGAAGGATGGAAGCTTAC
TACAAGATAGGAGACTCCAAGATATGGAATCAATGAGCCAAGAGATCCTC
CGCAATTCACTCAACGCAAATTACACTTCTCAGATGCAGGTTCAGATGTT
GACGGATGTCTACAATAAGGTATACCGACTC

Sequences in the Contig:

SY0AAA27YM07FM1 SY0AAA46YA15FM1 SY0AAA5YJ19FM1
SY0AAA63YM08FM1 SY0AAB31YP13FM1