Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig172
Length(NT) : 1113
Best Gene Model Blast : Link to GSTUMT00007956001 E-value : 0.0
Numbers of ESTs : 9

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE62934.1| Score: 802 E_value: 1e-83
KEGG Definition: thioredoxin/protein disulfide isomerase [EC:5.3.4.1]; K09584 protein disulfide isomerase family A, member 6
Accession: aor:AO090120000344 Score: 802 E_value: 7e-84
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0191 Score: 511 E_value: 2e-52
PFAM Definition: Thioredoxin, Thioredoxin. Thioredoxins are small enzymes that participate in redox reactions, via the reversible oxidation of an active centre disulfide bond. Some members with only the active site are not separated from the noise..
Pfam Number: pfam00085 Score: 337 E_value: 3e-32
Swissprot: Q00216|TIGA_ASPNG
Gene Ontology:
GO:0005788 = Cellular component: endoplasmic reticulum lumen
GO:0003756 = Molecular function: protein disulfide isomerase activity

Sequence:
>Contig172
TTGGATGCAACCCTTCCCCAACCCAAGATTACCTTTCCTTTCCTCAACAA
CACCTTCTACCTATCATACCGCTATATCAAAACCAGCTATCATTACTGAA
AATGAAGGATTTCTGCTCTCTATTCACGCTCGCTTCACTCCTGCTGGTCG
CTACAGCTAGTAATGTCATCGATTTAACTCCCGATAACTTCGACAAAGAG
ATTCTGCAGAATGGAAGGCCGGCATTGGTCGAGTTTTTTGCTCCGTGGTG
CGGACACTGCAAGAGTCTTGCCCCCGTCTATGAGGAGCTTGCGGATTCGC
TTGCTAGTCAGAAGGACAAAGTTGCGATTGCTAAGGTCGATGCCGATAAT
CACAAGGCACTCGGAAAACGGTTTGGTGTCTCCGGCTTCCCAACGTTGAA
ATGGTTTGACGGGAAGTCTGCCGATCCTATTCCATATGAATCCGGTCGGG
ACTTGGAAGCACTTCAAGCGTTCCTTAAGGAGAAAGTTGGCGGGTTGAAG
CTTAAGGCTAAACGTGAAGCGCCAAGCAATGTTATTGTGCTTAGTGACGC
CAACTTCGATAAGATTGTTCATGATGAGAAGAAGGATGTCTTGGTTGAGT
TCTATGCGCCATGGTGCGGTCACTGCAAAAACCTTGCTCCGATATACGAG
AAGCTTGCTAAGAACTTCGCCTCCGAGACTAACGTTGTGGTTGCTAAACT
TGACGCCGACTCTCCTGGTGGGAAGGCCTCTGCTGAGAAGTATGGCATCA
CCGGGTTCCCTACTCTAAAGTGGTTCCCTAAGGGGTCTTCTGCCAAGGAA
CCCATACTCTATGAGTCTGCAAGGTCCGAGGAGGCATTGACCCAGTTCAT
CAACAAGCATGCCGGTACCCACCGTGTTGTTGGTGGAGGTGTTGATGATG
CGGCAGGAAGAATTGCTTCCTTGGACACCATTGTCCAGAAACTTATTTCG
GGGGAGAAAGATGCCGAGAAGGAGTTGGCAAAGGCTGCCGAGGAGGTCAA
GGAGAAATATGCTGCATACTACCTTAAGGCAGCCGATAAGCTCTCTAAGA
ATGCAGATTATCCCAAGAAGGAGATCAAGAGGTTGGAGGGAATTGCCGCC
AAGGGTGGTTTGG

Sequences in the Contig:

SY0AAA15YI21FM1 SY0AAA16YE06FM1 SY0AAA28YH06FM1
SY0AAA39YL11FM1 SY0AAA48YC08FM1 SY0AAA52YB23FM1
SY0AAB1YK08FM1 SY0AAB31YJ21FM1 SY0AAC2YG23FM1