Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1719
Length(NT) : 592
Best Gene Model Blast : Link to GSTUMT00004511001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein An18g01610
Accession: ref|XP_001398621.1| Score: 242 E_value: 4e-19
KEGG Definition: hypothetical protein
Accession: ang:An18g01610 Score: 242 E_value: 2e-19
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: Q0CG59|MED17_ASPTN

Sequence:
>Contig1719
TTGGGTAGCTACTACCGGCTCACACGGCAAGGCTATGCTCCGGGTTCGTG
TTCTCGAGAACGGGGAAGTGAAGGGATCCAGTGTACAGAGTGGGAATAAG
TGCTCGGGGTCAGTTAAGGATATGATTCAACGGGCTAGGAACTTTATCTA
TGAGGATGAGCTCTTCTTTGAGATCACAAGGGAAGCTAGGCTCATGGCGA
ACTATGGTGTACGAACAAGTGAGGATGCGGTTACGATTGATCTAGGGGGG
GGTAGGAGTATAGTAATTGATATGGCACCTTTGGATGATGGCGATATTGT
TCTGGATATACACAATCCTGACAGTAATCTCGCACAGGGGGTTGTCACGG
CATTCCGTATCCTCCTGTCATACAATCACAGGATGAGCCTAAGGAAACGC
AGCAAGCCGCCACCACCTCTAACGCAGCGTAAAATAGTCCCTCCTGCTCT
CCGTATGGTTGCACCGATCACCACACACCTCTTACATCACCAACATCAGT
TGAATCTACAAAATCTACTCAGACACCTAATCAAAGTTGTCAAATCTGCC
GGAATGAGCACAGCATTTGTGACAAAACCCCGCCACAATTGC

Sequences in the Contig:

SY0AAA38YM01FM1 SY0AAA5YJ12FM1