Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1718
Length(NT) : 2407
Best Gene Model Blast : Link to GSTUMT00001110001 E-value : 7e-40
Numbers of ESTs : 17

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1718
TTGGGGAATGTATTATCTACCAGATTATTATTAATTCCTTTTAGGTGGGA
GGGTTAAATTATCTTGGAAAGTATATAAAGAAATTATTATGGATTATAAG
CAATATATCACAAGAGAGAACAACTATTTATTTAATTTGTGTTTAGTAAT
ACACATGAACTCTTAGAGAAATTAAGTAAAAAACGAAGTGAAAAGAAGGC
TCTTAGTAACTTTAGGAAAATAAATCAAAGGAGATTCTATTATTAGTGTG
AATGAAAATAGAAAAGCCTATAAATAAATAAGTAAAATGGATATTAATCT
GTTTGAATTATAAAGGGGAACCTTCCTCTAAGGCTAAATATGATATATTA
GCGATAGTGAATAGTACCGAGAGGGAATAATATGAAATAGTAATTTTATA
AGCAGCTCGAAAACAAATTTAAATAAATAATAAGAGCGTACCTTTTGCAT
AATGGGTTAGCAAGTTAATATTAGATGTAAGCAGTATTGCCCAGATAAAA
CGATTATAATATATATGACAAAATATCTAAAATTAGACCCGAAACCTAGT
GATCTTACCATAATCAGAATTATAAAAGTTCGAACGGGTTATCGTTGTAA
AGATATCCGATGAATTGTGGTAAGTTGGTGAAAGACAAAACTGACTAGGA
TAGCTGGTTTTCCGCGAAACCTATCTAAGTAGGCCATTTAAATAACATCA
TTGCAGGTACAGAAATTTTTAGATCTCATTAAAAACTTACGTTAACTTCT
TATTATTAAGTATATGAAGTATTCGGGGAATCGTGAAGATTTTACTGGTG
AGAAATTAATCTAGGAATGGTAATGATGAATGTTGAATAATCAGACATAG
AATGCTAAGGTTGTATGTCAAAAGGGAAACAGCCCACAACAAGTGTTATA
ATAAGGTTCCAAAATTATTATTAAGTGAAATCAAGGAAGTCTTTTGATTT
TAATTCGATCAGGAAATAGGCTTAGAAGCAGCCATTTTTTTGAAGACCTC
GTAATAGAGCACTGGTTAACAATGTAAAAAGGCATTGAAAATTTAACGGA
TCTAAAATAATATACCGAAACCTTGTCTATAGTTATAAATATTTATATTG
TATAACTATAGGGTAGCGGAACGTAGGGGATATAAAAGAATTTGTTCTTT
TTAAGAAAAAATAATATAACTCTAGTGATAATGCTAACATGAGTAACGAT
AAAGGCCAATCTATAGGTTGACCTCGCCTTAAGCTTATGGTATAGATAAA
AGTAACGGCCTCTAAGTTTATTAACCTAAAGGACTAAACGATGAGAAAAC
CTTGTTTATAAAGTAATAACCTTTAAATTTTTAAACATTCTGGGGTCGCA
CGCCCTCACTCTCTTTAGGAGTGAGTGATCGCGCCCCAATAGCTGATGTA
AATAATAAGTGATGAAGAGTTCAGGAAAAACGATAAACACTTAACCGTAC
CTAAATACCAGCTCAGGTAAGCAAGTAGAGAATACGAAGGCGTTTGAGAT
AACAATCATAAAGGAACTCGGCAAAATAGCTCCGTAACTTAGGGATAAGG
AGTACAGTTCATTACGGGGGGCGCTTATTTAGGCGCCCCATTAATATTAA
GTAGTGTTCAGGTAGCATAAAATCGAGTTGTACGACTGTTTAATTAAAAC
AAAGCACTTTGCATAAAGATAAAAATCTAAGTATAAAGTGTGAGCTCTGC
CCAATGTTTGAAGGATAACAAATAAGCTCAGTGTTTAACATAGGCTTAAA
TAGGAATCTCTTATGAATGGCGGCCTTATCCGTTAGGGTCCTAAGGTAGC
GGAACACCCTGGCCGTTAAATGCGGTCTTGCATGAATGATTTAACGATAC
AACAGCTGTCTCTATGATTGGCTCAGTGAAATTGGAATAGCAGTGCAGAT
ACTGTTTACCTCTAGATAGACGAGAAGACCCTATGCAGCTTTACTGTTGC
TAGTTATTGTGGTATGTTAGAATAAGGTTGTAGTGGACAAGGTAGTTGGT
TAGATGAAATTGAAACACCTTTACTTTTAACTATCATATTGCTGGGAAGC
CAGATTAATTTATGAAAACATAACATCTGAGCATATCTCCCCCGAAATAA
CAAATTGTTAAATTAGGGTGACCATATTATCATTAATTTTAATGAATATA
AGAATATTGGCTAGGTGGCAGTTTATGCGGGGCACAGATCCCATAAATAG
TACCTGGGTATAGTCCAAAATAGTAAAAAGTATTCGTATTTTTTTAATTT
AATTAAGTTTAAGATAATTTAATTATCTTATTTAAATTTTTATAATATAA
AATTAATCAAGAATAGATCTATTAAGTTAGAGATTTTATTTATTTAGTAG
TAAGAGTTACCTATATGGAAAATAGCAGAGAGGTATAATATATTAACTAT
AATAATG

Sequences in the Contig:

SY0AAA12YF09FM1 SY0AAA50YC15FM1 SY0AAA5YJ06FM1
SY0AAA8YB04FM1 SY0AAB21YH03FM1 SY0AAB24YF22FM1
SY0AAB34YJ19FM1 SY0AAB8YK18FM1 SY0AAC13YL19FM1
SY0AAC13YP07FM1 SY0AAC38YE15FM1 SY0AAC51YE09FM1
SY0AAC59YO06FM1 SY0AAD11YD19FM1 SY0AAD36YG14FM1
SY0AAD38YH10FM1 SY0AAD8YJ10FM1