Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1717
Length(NT) : 1733
Best Gene Model Blast : Link to GSTUMT00008609001 E-value : 0.0
Numbers of ESTs : 71

Blast Results:

Nr Definition: hypothetical protein SS1G_10943
Accession: ref|XP_001588496.1| Score: 382 E_value: 1e-34
KEGG Definition: hypothetical protein
Accession: fgr:FG05171.1 Score: 369 E_value: 2e-33
KOG Definition: No Hit Found
PFAM Definition: bZIP_2, Basic region leucine zipper..
Pfam Number: pfam07716 Score: 144 E_value: 1e-09
Swissprot: P22697|CYS3_NEUCR

Sequence:
>Contig1717
TTGGGGCATCTTTTTGTCCACTGGCCTCTTCTTCTCTCACTTCTTCCTCC
CGCGCTTCCTACAGACTCCCCCGCTTTTGATCCTCTGGGGATCAGTCTGT
CATAGCATTAACCAACTCCGGGAAGAGGAAAAAAGCCTCCCGGATCAAAA
AATCGGGAAAGGTTCAAGTAGGACTAATTTACGTTTTGTTTTGGTCATTT
CCAACCCCTCCGGATTCTCGGGTTTTATACCGCTAGCCAAGGGTTGGTCG
GTCCATCACTCAATTAATCAGCATAGCCGATTCACCCACAAAGAAACTCC
CCACTCAGTACTCCCCCACCCACCGCCATCCGCTGAACTTTCGTTAATTC
CCCTCTGCCCGCCAAATTTTACAGATTTGTACAGTCATAATCACCACTCC
CTCCACATCCCACATTTGCTTTGGAAATGGCTGGAACCTACAGCGGCCGT
CGTAGCGGGGTTAATGTTTCCTCCTACATTGAAAATCTCAACTCGATAAC
CGCAGACGAACCCCTTCCTGACCTTCAGGATGATCTCGCCCTGTTTACAA
ACATCTCATGGATCGACTATGACATGTGCCGGCCGTTGGACGACGGAACT
TCCGACGCACTCAAGCGTTCGGAAGACTTTGCTGCTCTTGACCAAAAACC
CAGTGATGAACAAATGAATTTCATGAATGATATCGACAGCAGCTTTGTGC
TATCGAAATTCGCTCTTGATGGCGCATTAGAGACTCAGCCAACCACGGAT
ATTGTAAACCCTTTTGCCCCTGATGGCACTTCCTCAATCGGTCCGGTCGA
CTCTGTCATGCACTCGCCCGCCTCAAATTCGCCCACCGCATATCCGCAGG
CGAATAACGGCACTCGCACATCGGCCAAGCGAAAAGGGTCTGCGGTATCA
GTGGCATACACCTCACCACAGGCTGACAGCTTCGAAGAGGCCTCTCGACT
CGCAGCAGAAGAGGACAAGCGTCGTCGTAACACGGCAGCCTCTGCAAGGT
TTCGTGTCAAGAAGAAGCAAAGGGAGCAAGCTCTGGAACGATCGGCTAAG
GAAATGTCTGAGAAGGTCAGACTTTTAGAGAAAAAGATTGTTCAGTTGGA
GACGGAGAACAAGTGGCTAAAGAGCCTCATCGTTGAAAAGCAGACTCCGA
ATAGTGGTAAGGGTGCTCAAGACCCGAGTGAAGATTTTGCTGCCAAGTCC
CCCGCGGCAATGAAGGCCGGGGCCTCTTCCAATGAACCGAATACCAACCA
GAACAAGGATGGCGTCGGCACAATGCCAGAGGTGAATTCCAATTGACCTG
TCACTTGTCACTTGTTGTTTTGTTGCTATTTTATTGTTATTTCTTTCTAT
TCTATGCAGTGTTTTCCTTCTCCAATTTTTTCTTTCTTTCTTTCTGTATG
TCTGACTAGGTGGTTTTTTCATATGGTATTTTTAAAAAAAGATCAGGTGG
GATGGGAGGACTGATAGTGGGGAGTTATTTATGTTGTGGCGGTAGCCTTG
TTTTCCCTCCCGTTTCCTTTCCCCTCACCTATTGTGCGGCGGGACTATTC
CTGGGTCTGAGAATAAGTTTGCTCGTTTTCTGTTTCTTGCACATTACGTT
TTAACGCTATGGTTTTTGTCTATGCATTAAGAATATCTTTATGTATGTAT
AAATACACGGTTCCTGTAATGGGGGATATAGACTTGATTTATGGTTATAA
CACGAAGTAGTGAACACGAGGCGTTTAGGGTAT

Sequences in the Contig:

SY0AAA16YE24FM1 SY0AAA18YA03FM1 SY0AAA18YL07RM1
SY0AAA27YO04FM1 SY0AAA28YK22FM1 SY0AAA2YP18FM1
SY0AAA30YP05RM1 SY0AAA31YH07FM1 SY0AAA32YL18RM1
SY0AAA37YA20FM1 SY0AAA37YB20FM1 SY0AAA40YN08FM1
SY0AAA42YO14FM1 SY0AAA46YM22FM1 SY0AAA46YO01FM1
SY0AAA4YE19FM1 SY0AAA52YC14FM1 SY0AAA52YE18FM1
SY0AAA53YK24FM1 SY0AAA56YN14FM1 SY0AAA57YL06FM1
SY0AAA58YD11FM1 SY0AAA5YI12FM1 SY0AAA60YE03FM1
SY0AAA60YI13FM1 SY0AAA61YN05FM1 SY0AAA6YG13FM1
SY0AAB13YB01FM1 SY0AAB14YL13FM1 SY0AAB1YN14FM1
SY0AAB29YI24FM1 SY0AAB30YI23FM1 SY0AAB30YJ17FM1
SY0AAB33YF08FM1 SY0AAB36YD03FM1 SY0AAB39YC10FM1
SY0AAB40YN18FM1 SY0AAB42YB07FM1 SY0AAB45YD18FM1
SY0AAB48YK01FM1 SY0AAB4YL14FM1 SY0AAB50YK10FM1
SY0AAB51YJ09FM1 SY0AAB53YE04FM1 SY0AAB54YP22FM1
SY0AAB58YI24FM1 SY0AAB59YH21FM1 SY0AAB6YA11FM1
SY0AAB8YK02FM1 SY0AAB8YL07FM1 SY0AAB8YN04FM1
SY0AAC23YN08FM1 SY0AAC28YN19FM1 SY0AAC29YP13FM1
SY0AAC40YG15FM1 SY0AAC47YP14FM1 SY0AAC48YJ11FM1
SY0AAC50YD06FM1 SY0AAC52YH23FM1 SY0AAC53YG08FM1
SY0AAC8YA07FM1 SY0AAC9YC06FM1 SY0AAD20YN20FM1
SY0AAD34YE14FM1 SY0AAD34YO04FM1 SY0AAD38YE14FM1
SY0AAD39YP03FM1 SY0AAD52YD06FM1 SY0AAD59YJ21FM1
SY0AAD60YL21FM1 SY0AAD8YN04FM1