Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1716
Length(NT) : 1766
Best Gene Model Blast : Link to GSTUMT00005465001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: hypothetical protein SNOG_10771
Accession: ref|XP_001801031.1| Score: 621 E_value: 3e-62
KEGG Definition: hypothetical protein
Accession: fgr:FG09921.1 Score: 607 E_value: 5e-61
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: P87000|ACU15_NEUCR

Sequence:
>Contig1716
TTGGCAAGCTTTTTAAAGATGAGGACATTGATACAGAGTATCCATCCGAT
ATTGACGACGAGTATGTTTCCGAAAAGGGCTTCTCACCAACCCTACCGGG
GGATTCCACAAAGATTTCAAGCGCACTGGCCCTATTCAGATCATCAAGGG
TTCTCTCTAAAGTTCTTGATGCGGTATACCCTACATCAAGCTCTCATGAA
GTGAGCTATACTAAGCTCAGGGAACTTGAGGACGAGCTTGGGGCGTGGAA
GAGCGGACTAGCACCACATCTTAGACTCGAGTTTGTGAATGGCACACCAG
CCACCAATGTCGTTGACAGCCGATCACCACTATTGGTGCTGGCCTATCAT
TATATTCGATCATTGATTCACAGACCGATTATTGGCTCGACCTTAGATAG
CAAAGTATCTGCATCTTTGCATATGATCCGAGAGTCCAGCAAATGCATCA
TTCAGATTATTCAATTGCTCACCGAACGTAAACTCGGGTTTTCGTTCTGC
CTCAACAAAACGCAATTGCTCCTTATGTCCGGGTTTACTCTTTTGCACAG
CACATTAGACTGCCCACAACACACACCGTTGGCGAAGGAGAACCAAAGGC
TAATTACCGGTGTTTTGGAGGAAATCGAAAGCTGTCACCCCCTTGTGGCC
AAGGAACTTAGGCCCATCGCCGCTGCGGTTGTAAATATCGAGCCGCGGGT
AGCCGCGAGCAGCAGAAACCAACACGAGAAGCCAAAGGAGCATACCCAGT
CACCCTTAACGCCACCTTTGGTCAGTCCTACAGAGCAAGGACCACTGCGG
AGGAGATTTTCTTCGATCTCGGCAGAGTTTAGTTTACGCAGAGGCAAGAG
TGGGGACATCCGTCGTGCAAGTAGCCAGGACATGTCTGGTATGGGTGACC
ATGGCGGTGTTCGTCTGACCTCTGCGTCACTCACGGATCTATCACCTACG
CCTCGAACCCGATATCCTGCAGCCAGCCATGCGGCAACAGTCAAAATTTC
TCAAGGACGCCAAATCCTGATTTCTGATTCACCATATCTCGATGGTCCCT
GGGACATGGGATCCAATGACCTGCATCCGAACTCGCAGAACCCGCCCCCG
ATATCGGCGTATGATTGGGAGAGGCTGCTAGCCGCAATGGACCAGACACA
CGCAACGCACATTTACGGAGGAGAGGATAGGGGCAGCGGCACTTTCATCC
ATCCCTCTGATTCCCTATCTGCCGAAATAGGTACCCGGCCGGTAGATCAG
CATTGGAGTCTGAGTGAAACTCCCACAACCGCGTCCTTCCGCGGTACCCC
GCCGTCCATATCGTCGTTCTCCACGTTGTCGGAAGAGAGTTTCACTGGCG
GCGACGACGTGCGGGCCGATACAGGAGACCTGGACGTTGACAGTGGCTAC
ACCGATAGCGATAACCTGGGCGACTTTCTTGGACCGCTGATGGGCACGCG
GAGTGATGGTTCAGGTGGGGTGTTACTGGAGAATTCATGGCACATGTGAC
GGGGCTTTTTTTTCCCTTCTTTCGTCCCCTTTATTCCCTATTCTACCTAC
CTCTTACTACTTCCCTTTCTTTCTTTCTCTCTTTGCTCTACTGTAACCCC
CTTTTTTCTTTTTAACCCTCCTCACTTTAAAACGGTTTCCCTCCTCTCGT
GCTATATTATCTCTTCTTTTTTCCTTTCTTTTCTTTTTTTATATTCCCCA
CCCCTTCCATCCATCAATCCTTCCATCCTACTTCCCCAAACAGCGTTGTC
CCCCCCTCCCCCCCCA

Sequences in the Contig:

SY0AAA5YI11FM1 SY0AAB46YK06FM1 SY0AAB52YC14FM1
SY0AAC16YC20FM1 SY0AAD38YN21FM1