Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1715
Length(NT) : 698
Best Gene Model Blast : Link to GSTUMT00006283001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: eukaryotic peptide chain release factor subunit 1
Accession: ref|XP_001542880.1| Score: 928 E_value: 2e-98
KEGG Definition: peptide chain release factor eRF/aRF, subunit 1; K03265 peptide chain release factor eRF subunit 1
Accession: afm:AFUA_5G05680 Score: 919 E_value: 9e-98
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG0688 Score: 924 E_value: 1e-100
PFAM Definition: eRF1_1, eRF1 domain 1. The release factor eRF1 terminates protein biosynthesis by recognising stop codons at the A site of the ribosome and stimulating peptidyl-tRNA bond hydrolysis at the peptidyl transferase centre. The crystal structure of human eRF1 is known. The overall shape and dimensions of eRF1 resemble a tRNA molecule with domains 1, 2, and 3 of eRF1 corresponding to the anticodon loop, aminoacyl acceptor stem, and T stem of a tRNA molecule, respectively. The position of the essential GGQ motif at an exposed tip of domain 2 suggests that the Gln residue coordinates a water molecule to mediate the hydrolytic activity at the peptidyl transferase centre. A conserved groove on domain 1, 80 A from the GGQ motif, is proposed to form the codon recognition site. This family also includes other proteins for which the precise molecular function is unknown. Many of them are from Archaebacteria. These proteins may also be involved in translation termination but this awaits experimental verification..
Pfam Number: pfam03463 Score: 435 E_value: 6e-44
Swissprot: O59948|ERF1_PODAN

Sequence:
>Contig1715
TTGGCAAACACTTGTTAATCCAACGAACACCTAAGAGCAGGGTAACGGCG
AGAAAAATAAAAATAAAAACCAACCTATCGTCATCATGTCTCTGCCCCAA
GCAAACGACATGGAGAAAAACATCGAGATCTGGAAGATCAAAAAATTGAT
CAAAAGTCTTACTGAAGCACGCGGTAACGGAACCAGTATGATTTCCCTAA
TCATTCCGCCAAAGGATCAGGTCTCCCGCGTCGGCAAGATGTTGTCTGAT
GAGTACGGCACCGCATCCAACATCAAATCCCGTGTCAATCGTTTATCGGT
TCTTTCAGCTATCACTTCTACTCAGCAACGTCTCAAGCTCTACCACAAGG
TTCCCCCCAACGGGCTCGTCCTCTACTGTGGCGAAATCATCACCAACGAA
GGCAAAGAGCGTAAAATCAATATTGCCTTTGAGCCCTTCAAGCCAATCAA
CACCTCTTTGTACCTCTGCGATAACAAATTCCACACTGAGGCACTATCGG
AGCTTTTGGAGTCTGACTCTAAGTTTGGCTTTATCGTGATGGACGGTAAA
GGTGCTTTGTTTGGAACTTTGAGTGGAAACACTAGAGAAGTCGTTCACGG
GTTCTCTGTTGCCCTTCCCAAGAAGCATGGTCGTGGTGGGCAGTCCGCAT
TGCGTTTCTCACGACTCAGAGACGAAAAACGCCACAATTACGTCCGCA

Sequences in the Contig:

SY0AAA52YE10FM1 SY0AAA5YI05FM1 SY0AAC44YN06FM1
SY0AAC52YO19FM1 SY0AAD49YP09FM1