Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1714
Length(NT) : 941
Best Gene Model Blast : Link to GSTUMT00000168001 E-value : 0.0
Numbers of ESTs : 14

Blast Results:

Nr Definition: 40S ribosomal protein S6
Accession: ref|XP_001557655.1| Score: 1041 E_value: 1e-111
KEGG Definition: conserved hypothetical protein
Accession: fgr:FG00634.1 Score: 1029 E_value: 1e-110
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG1646 Score: 943 E_value: 1e-102
PFAM Definition: Ribosomal_S6e, Ribosomal protein S6e..
Pfam Number: pfam01092 Score: 539 E_value: 9e-56
Swissprot: Q9C0Z7|RS6B_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol

Sequence:
>Contig1714
TTGGCGACGACAATCGACAAACCACCAGGCGCACCGAATTTTCCCCCTGG
TAAACCAACAAAGTCGACGCAAACATGAAGCTTAATATTGCCTATCCCGC
CAATGGGTCACAAAAACTCATTGAAATTGAGGATGACCGTCGTCTCCGTG
TCTTCATGGATAAGCGTATGGGACAAGAGGTTCCTGGGGACAGTGTTGGA
TCGGAATTTGCTGGGTATATCTTCAAGATCACCGGTGGTAACGACAAGCA
AGGTTTCCCTATGAAGCAGGGCGTCATGCACCCTACTCGTGTCAAGCTCC
TCCTCTCTAAGGGGCACTCTTGCTACCGCCCCCGCAGGACTGGAGAGAGG
AAGCGCAAGTCTGTTCGTGGATGTATTGTAGCCGGAGACCTCGCTGTCCT
TTCCCTCGTTGTCGTCAAGCAGGGTGACGGTGATGTCGCTGGATTGACCG
ATGTTACCCATCCCAAGAGACTCGGACCCAAGCGCGCTACCAAGATAAGA
AAATTCTTCGGTTTAAATAAGGACGATGATGTTCGCAAGTTCGTTATTCG
TCGCGAGGTCCAGCCCAAGGATGAGGGGAAGAAGCCATACACCAAGGCTC
CCAAGATCCAGAGGCTCGTTACCCCTCAACGCCTTCAGCACAAGCGTCAC
AGAATCGCCCTCAAGAGAAGAAGAGCGGAGGCTTCCAAGGATGCTGCGAA
CGAGTACGCGGCTCTCCTCGCCAAACGCGTCCATGAGGAGAAGGCGAAGC
GTTCTGAGCTACGCAAACGCCGTGCTTCTTCTATGAGACCCGAGAAGAAG
GAGAAGGCGTAAGTGTTTGTAGGTGGTGGTTCAACAAAAAAATAAAAAAT
TCTTTGGTGCGAATGGGTGGGGTGGTCGGAACTAAACAGTGCTTTTCTTC
CTCTTTTTTTCACCTGTACCTTCTTCACTGAATAAAGTGAT

Sequences in the Contig:

SY0AAA20YH15RM1 SY0AAA47YG10FM1 SY0AAA5YH14FM1
SY0AAA63YA07FM1 SY0AAB23YB23FM1 SY0AAB40YP03FM1
SY0AAB44YG16FM1 SY0AAB50YL19FM1 SY0AAC3YO21FM1
SY0AAC45YD23FM1 SY0AAC8YG14FM1 SY0AAD25YC07FM1
SY0AAD46YN02FM1 SY0AAD60YH10FM1