Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1713
Length(NT) : 727
Best Gene Model Blast : Link to GSTUMT00002821001 E-value : 9e-46
Numbers of ESTs : 2

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1713
TTGGCACACTCTCAACAACTCGCTTACTAGAGCACTTGCTCGGATTCGAA
ACTCAACTAAACTAACAGGAAAAGACAGGAGAATAAATAAACGACAAAAA
GACATCTCCCACTCGTTCCAAATATCCTCTATCTCGTCTACACACGACAA
AGACTCCTGCAGCATCCCCCAGACTCTCCCGCTCCCTTTGTCGCAATTTC
TTCCTCCGGATCCCTACCTTGTGATTCCTTCCTTCTCCGGTGAACAATAA
ATAGCGCACGAACGAGCAAGCGAACGGGAGAATCAGTGAGCAAACTAAGG
ACGGACAAGGGAGCGAACGGGCGGCTAAGAGAATGAACGAATGAGCAAAC
TAGTGGAGGAGCAAACAAACTGATATGCAGACAGGCAAACGTACAGGCGA
GCCAATGAACGAACAAAACAAACCGGGACAACGAATAACCGGGTAGACGA
CCTCACGGACGGGCGAGCGAGCGGACAAGCAAACAAAGCAACGGACGGAT
AATCATGGAAGGCAAAGAGCAAAGCGCATAAGCATGCCGAGCATGTTGGG
AGGTGGGCAATATTTTGGCCCTGAAATACACCCTTCTTGATCACGCTAGA
AGACCGACCATTGCGGGGGTTCGTGGAATCGGTGGATGGATTTATATGAC
TGCACTCGACAAAACTTTGTAGGCTCTTCGAATAGATTCGAAGTGGTCTG
CAGCACATTGGGAAAACGGAGGCCATG

Sequences in the Contig:

SY0AAA5YH07FM1 SY0AAB35YH09FM1