Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1711
Length(NT) : 2753
Best Gene Model Blast : Link to GSTUMT00001791001 E-value : 0.0
Numbers of ESTs : 16

Blast Results:

Nr Definition: AAA family ATPase, putative
Accession: ref|XP_001273411.1| Score: 1926 E_value: 0.0
KEGG Definition: hypothetical protein
Accession: ang:An07g02150 Score: 1902 E_value: 0.0
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0742 Score: 138 E_value: 8e-09
PFAM Definition: AAA, ATPase family associated with various cellular activities (AAA). AAA family proteins often perform chaperone-like functions that assist in the assembly, operation, or disassembly of protein complexes..
Pfam Number: pfam00004 Score: 179 E_value: 1e-13
Swissprot: Q5T9A4|ATD3B_HUMAN

Sequence:
>Contig1711
TTGGGGAGGAGGGGGATGGAAAAGAGAGAGCAAGTGTCTTGGAGTACAAG
AGGGTCGATGAATTGTGGGATAAGAACATACACGATTATACGATAACCGA
TACTGTTGCGCATACAAAGACCGACAAGTACTCCTCGTTTATCTTTACCG
TTCGCCGTGTCTTCGATTACGAAAATAAATATGTGGAGACCATGGTTGAT
ATCAAATCCATCCTATTGAAGGAGGCCTTAACTGAGATCATCGGTGACGT
TAGGGGAGTCTCTCTTGTTGAGGACGTTCCCGAGGTTGATCCTAATATGC
TGTTCAACTTCCTCCCCGAAATGGAGGCCTGGGTTGCGAAGAAGGCCGAG
TCCAAGGAACTGAAGGAGCCTCCAAAAGAACCTCCTAAGCAAAAGAAGAT
GGAACCTGGAAAGCCTGAAGATATTCCTCTGACACCCGAGGAGATTTCTC
AACAGATCGATCAAGTCAAGCTCTTGATTGGGTATTTGAACACAGATTAC
GCTGGTGTTAAGGCTACTTTGTATCCTCTCCTTGCGAACTCAATGATTAC
CTTCGACTTGTTGTGGGCTCTGCTAAAGCCCAACACTATGATGTATACTA
CTTGCGCTGGTAGTAATGAGCCGAGGGCGTTCAAGCTAGAGTACGCCCAG
AAAGAGTCTAGTTTTATGAGGGGTAAATGGTGGGGTATTGAGGGTAAATA
CCTGGAGTATGCTGGTAAGGACAGCAAGCCCTCCGAGGCAAACAAAGAAG
TAGGCGGTTTCGGTTGGGGTACTATCATGGTTGACATTGATGGGTTCAAG
GGAGCGAGAAAAATTTCTTCGCTATCCTGTTATCCATTGGAGTATAGGAA
AGATAAGGACACCATGAGGGAAACCCTGGTTGAACGTGGCCGCAAATTTG
TTTCATTAAGAGGAATGCAGTACAAGATGCACAAGGGGCTGGCGTTCATG
AAAAAGAAGAGGCAATACGCCAAAGTTCATGTCAAAGGGCGTATCATGAT
TGACCCCGCTACATTCCGAAGGATCAATCCGAATTATCTTATCTCTTCAG
TCAAGTCCCGCAACAACGACGAAGAGGATGATAATCAAGTCAATTTCTTT
GATGCCGAAGGGCAGAATGGCTCTTCGCCTTCCTCGGAAACCGGTGACTG
CACTGACTGCTGTTGTGGTGGCGAAGGGGAGGAGGAGGAGGAAGGGGAGA
ATGAGATACCGGCAGAAACTGAGAAGCATAAGATTGTGACAGATGGAAAA
GGGGCATTTTATGTGGTCACTGAACAAGAAGCGAATGATAAGTCAATGAG
GGTGGAGGCCCTGCCAGAGGACGGTGATGAAGAGGCGGAGCCTGTGTTCA
CTGACGATGAACTTCTTACTGCTTCACCAGTCGTGCTTGGATGGTCATTC
AATGAAAAGCTCTGGTTGGAATTCACTGTTTCCGGAGTTGAGGAAATTCA
GTGGAACGAAAAGGCTTTTGATTCCCTTGTGCTTGCCGAGGAGCAAAAAG
AGATCGTCAAGGCATTGGTCGAATCGCACTCTGGTAATAACATCGCATCT
GCCACTATTGACGATGTTATCCAAGGCAAGGGTCGTGGATTGGTGTCGGT
ACTTCACGGACCTCCGGGTGTGGGAAAGACTTTAACCGCTGAAGGAATTG
CCGAACTTTTGAAGAAACCCCTGTACTGTGTTTCTTCGGGAGAGTTGGGA
ACCAACCCTGCAGTTCTTGAGCACGAACTTAACAAGATCTTGGACATTGC
TCACTCTTGGGGTGCTGTGTTGTTGTTAGATGAGGCTGATGTGTTCTTGG
AGCGGAGAACAATGGCTGATATGCATCGTAACGCTTTGGTGTCAATTTTC
TTGAGGCTCTTGGAGTACTTCCAGGGCATCTTGTTTTTGACCACCAATCG
CGTCGAGACATTTGACGATGCATTCCAGAGCAGGATTCACGTTGCTCTTC
GGTATAACGAGTTGACATTCAAGGCAAAGGTAAAGATTTGGAAAATGTTC
TTGGAGATGGTTCGTGTCAAGTACGGTGAGGATGCGCCTGAGGTTTTGAG
CCAGGAGGAGATTGAGTGGTTAGCAAAGAAACACCTCAATGGCAGACAGA
TCAAAAACTCTGTCAGAACGGCACAGGCCTTGGCGAATAATAAGAAGGAG
CGGCTCCAGATGAAACATATCAGAACTGTTCTGAACGTTGCTGAGGGGTT
CGAAAATGACTTGAAGGGGACTGGCCAGCTAGATAGCATGCATGCGTATG
CTTGATGGAGGCTGCCGGAATAGATGGACAGACGGAATAGGTATTTCAAT
TGTTTTACTGTCATGACCTTCTCGTTTGTGGCTGAGCCTTTTCTTCTCAA
TTCTCTTCTCATTAGCGATGTTTTTATAATATCATACCTCACCTATCTTT
TTGTAACATGTTACTATATTTTTTTGCTCTGCTTTTTATGCCTTTGAGGG
CGCTTTTTTTTTTCTCTTGTATTTTTTTCACTTGTTTCTATGGTTGAATA
TTTCAGTCATTTCATTTTGGCTCGGAGCGGGTTACGGTTATGTTATGGTT
CTGGGCGATTTACAGGTCATAATGGGTGTTATGATGTTTTTATACTGGGA
GGCGGGGATTTATGAATTGGGGAGTGAATAAGAGAGGCAGGGAGAGGAGG
AGAGGTGTTTTAGGCATGGATGGGGCAGTGTAGAGTATACTGTTTGGGCG
AGCATTGGTTAGAAGGGGTAGCCTGAAGAATAGAGAGGCGGCTGGGGAGA
TTG

Sequences in the Contig:

SY0AAA10YM17FM1 SY0AAA1YG19FM1 SY0AAA40YK20FM1
SY0AAA56YM19FM1 SY0AAA5YD13FM1 SY0AAB40YD06FM1
SY0AAB42YB24FM1 SY0AAB46YO22FM1 SY0AAB5YI21FM1
SY0AAC28YI07FM1 SY0AAC3YF12FM1 SY0AAD23YP24FM1
SY0AAD51YM14FM1 SY0AAD58YJ04FM1 SY0AAD60YE18FM1
SY0AAD63YE03FM1