Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1710
Length(NT) : 773
Best Gene Model Blast : Link to GSTUMT00005794001 E-value : 0.0
Numbers of ESTs : 7

Blast Results:

Nr Definition: hypothetical protein NCU10059
Accession: ref|XP_963705.2| Score: 548 E_value: 2e-54
KEGG Definition: hypothetical protein
Accession: ncr:NCU10059.1 Score: 548 E_value: 1e-54
KOG Definition:
Classification: [Carbohydrate transport and metabolism, Secondary metabolites biosynthesis, transport and catabolism].
Kog Number: KOG2741 Score: 149 E_value: 9e-11
PFAM Definition: GFO_IDH_MocA, Oxidoreductase family, NAD-binding Rossmann fold. This family of enzymes utilise NADP or NAD. This family is called the GFO/IDH/MOCA family in swiss-prot..
Pfam Number: pfam01408 Score: 187 E_value: 4e-15
Swissprot: P49307|MOCA_RHIME

Sequence:
>Contig1710
TTGGCCACCCACCGAATACTAGACGCTCCATCAAGTCCCTATTCCCTCTT
TCTGGCGTTCACAACGGGTGTAATGGCAACTACTATCAAAAAGTTGTTCT
ATGGAAAAGACACCCCACCCCCCCCTTACGAAACTAGTTCCTTCAGCGCA
ATACTTGGGGCTACTCCCCCGAAACCGGAGAATAGCCCGCGAATCTTGAT
AATTGGAGCTGGATCACGGGGGCGCGCCTATGCAAGGTCGATCGCTACGG
CCACAAACGGAACAGTTGTTGGCGTTGCGGAGCCGGATGGGTATAAGCGG
AGGATGCTTGTTCAGGAGTATAACATCTCTGGTGAGCTAGTGTTTGCTTC
GTGGACGGAGCTCGTCGGAGAGCACAAGGGGCTAGTCATGAGTCGGGTAG
ACGGTGTTTGTGTTTGTACCCTTGATGAGACTCATGAGGAGATTGTGCTC
GCCATTCGACCGCTGAACTTGCATATCCTGTGCGAGAAGCCGCTTGGAAC
CACGCTCGAGTCCTGTGTTCGAATAGCCGACACCATTTCTGATCCGGACC
TACCTCCCGTTTTGCTGGCGGTTGGGCATGTGTTACGGTATTCGCCGCAT
AACATACTTATGAAGAAGCTCGTCTGTGAGGATAAGGCCCTCGGGGAGAT
AGTTAACGTTAACCATACCGAACCGGTGGGGTGGTACCATTTTGCTCATA
GTTATGTTAGAGGTAACTGGCGTAGAAAGGAAACTGCTGCTCCATCACTA
CTGACGAAATGTTGTCACGACAT

Sequences in the Contig:

SY0AAA33YD02FM1 SY0AAA4YI12FM1 SY0AAA50YM14FM1
SY0AAA5YD04FM1 SY0AAB30YA05FM1 SY0AAC47YH14FM1
SY0AAD31YD21FM1