Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig171
Length(NT) : 840
Best Gene Model Blast : Link to GSTUMT00011706001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein CIMG_01443
Accession: ref|XP_001247672.1| Score: 667 E_value: 4e-68
KEGG Definition: hypothetical protein
Accession: fgr:FG03114.1 Score: 625 E_value: 1e-63
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones, Inorganic ion transport and metabolism, General function prediction only].
Kog Number: KOG2195 Score: 523 E_value: 5e-54
PFAM Definition: Peptidase_M28, Peptidase family M28..
Pfam Number: pfam04389 Score: 202 E_value: 8e-17
Swissprot: Q7M758|NALDL_MOUSE
Gene Ontology:
GO:0016324 = Cellular component: apical plasma membrane
GO:0043275 = Molecular function: glutamate carboxypeptidase II activity

Sequence:
>Contig171
TTGGCAATGGGACCATCGAGGATGAGGTTATCGTTATTGGGAATCACAGA
GACGCCTGGATTGTCGGCGGAGCCTCGGATCCCAATTCCGGAACTGCAAT
GCTGGTAGAACTATCCAAGGCGTTTGGTGAGCTCTTGAGACAGGGATGGA
GGCCCAAGCGTACTATCGTGTTGGAGTCCTGGGACGCCGAAGAATACGGA
ATGGTCGGGTCAACAGAGTGGTTTGAAGAGTTCGTGACGTGGGCTGTGCC
TAATATGGTGGCGTATGTCAATGTTGATGTGGCTGTTTCGGGGTCGCACT
TTAGTCTTGCAGCCGTACCAGAGCTGTGGGGTCTCGTCGAAGATACACTC
AAAGACACCTCATCTCCGAAAACACCAGGAAAATCTATCTATGACGAATG
GAGTACACACAAAGGTGTAACGAGAGTCCCCGGTTCCGGCAGCGACTATA
TGGCCTTCATTCATACCTCTGGAATTGCCGTCATCGACTTTGGCTTTAAA
AACGGTCCTGGGGAACCGGTATACCACTACCACTCTAACTACGACAGCTA
TGCCTGGATGACCAAGTGGATCGACCCATCCTTCTCCTACCACTCGGCGA
TGGCGCAAATCGCCGGTAAGACCGTCTTACGAATCTCCGAGAATGTCCTC
CTCCCATACAACGTCACCACCTTCTCCACAGCCCTGCATTCTATGTTCCT
AGACCTGAAAGGCGAGATGGAAGACGCTGGGATGGCGCTAGATGTGTCAC
GGCTGGAAGCCGCGATTAGTAGGTTTACTGTTGCCGCCAAGAACCTCATG
GCGATTAAAGAGGCGTTGGAACCAGGAGAATGGGGTGGTG

Sequences in the Contig:

SY0AAA16YC10FM1 SY0AAC31YH12FM1 SY0AAD14YK23FM1