Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1708
Length(NT) : 800
Best Gene Model Blast : Link to GSTUMT00004722001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein BC1G_09847
Accession: ref|XP_001551680.1| Score: 351 E_value: 2e-31
KEGG Definition: hypothetical protein
Accession: uma:UM05700.1 Score: 281 E_value: 1e-23
KOG Definition: No Hit Found
PFAM Definition: DUF262, Protein of unknown function DUF262..
Pfam Number: pfam03235 Score: 123 E_value: 1e-07

Sequence:
>Contig1708
TTGGGGGGACAACTTTGTACAAAAAAGTTGGGAAACCCTTACGGAAAGGG
AACACGAACGTGATTTTTTCTCCGACGACTCTTATCCCGAGGACACTCCG
GATACAACTCCTAATTATAACCCTGGCGAAATTCTTAACGAAGCAGATTG
GCAGAGGAGAAGTATCAGTGATCTTTGTCGTTTGATTGGAACCAATTACC
TTGACATCAATCCAAGTTACCAACGTGATGTTGTCTGGACTAACGAACGT
ATGAGTAAGCTCATCCAATCGGTATTGGCAAACTTTTACATTCCACCAGT
AATTTTCAACGTTATCAAGTTTACAGAAAATGGAGAAGAGAGATACCGCC
GTGTTTGTATCGATGGTAAACAACGACTTACATCCATTAAGCGTTTCGTT
GACGGTGGAATCCCAGTTTTCGATCACAAGGGCCAAAAGTGGTTTTATGT
TGATAATGGTTCTGCAAAAACTCAAAAGAAAGTCTTGCCTTCTGGAATTA
AAACTCGCTTTCTTCAAACCGATATACTCTGTGTAGAGTACGATTCGCTC
GGTCCGGAGCAAGAGGAGGACCTCTTTTCTAGGGTTCAATTAGGCGTTCC
TCTAACACCGGCAGAAAAGCTTAAGGCTAGTACCGGTGAATGGCAAGCAT
TTGCTTCGGAAATTGAGCTCACTTATGAGAACCTTATGCAATGTGCCGAC
AACAAGCGTGCTCGGAGTTTCCAACTCATTCTTCAGATATTTAAGCAGAT
GACTTACTACGAGGAAGGAAAAGCAACCACGTTTAATTCTGGTCCCAGCG

Sequences in the Contig:

SY0AAA5YC20FM1 SY0AAA63YN18FM1