Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1707
Length(NT) : 796
Best Gene Model Blast : Link to GSTUMT00002245001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1707
TGTACCAAAAAGTTGGCCCGACTTATAGTCTACCTACTCGTATATCCTTG
GGTTCTTAGAATCAACTCTAATCCTTTACCGATACATCTGGCTTTGCCTT
GAGCCGGTTGGTTGGCAGCCATGGACATTCTCGGCAGACACCGCATCGCG
TTCAATAACCTAGGAGTGCAGCTTTTTGCGGATCTTGAGAGGGACCTAGC
TCCCGTGTTAACAAAAGGGTTGGGTGAGAAGGCAGATCTGGAGAGGGTAA
TTGCGGAGCAGAAGGAACTTTTGCAGGAGAGGCAAGCTTTGGTTGATGCA
TATCAGAGCGCTAGCGAACAACAGCAGCAGAAAATCCGAGAACAGGAGAA
CCGGCTACAGAGTCTGGGCTATGGGATAGCCAAAACCGAAATTGAGAACG
AAGCTCTGGTGGAAAGACTTGAAGAGATTGAAAAGGCTGATAGAGAGCGT
CAGCGTAGAGCGCTAGCTATCACCAAGGATAAATCCTTAGAAAACAAAGA
AAATATACCACCTGTTTTTAATTATCTCGCACAAAACACCCCGAGTCGAA
CCCTCACACGGCCAGTATCCCCACCTCCAAAGCCTCTGAATAAGCCACGG
ATACCATCGAGCACTCCAGCAGGCGGAGCGACACGAACACTATTTTCTTA
CAAAGATGGTGAAGTTCAAACGGACCCTATTTACTCGTTGGACGATCTAA
AGAAGGCGTATCAGGAACTTGCTTCTAGCTACAATGATATTCATTATGAG
CTCGATCAGTACAAGGAGGCATACAGTCGTCTGGCCGAGAAATATG

Sequences in the Contig:

SY0AAA5YC18FM1 SY0AAC62YD10FM1