Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1706
Length(NT) : 1002
Best Gene Model Blast : Link to GSTUMT00008023001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: related to cell division control protein CDC91
Accession: emb|CAE76579.1| Score: 741 E_value: 1e-76
KEGG Definition: hypothetical protein
Accession: ncr:NCU00924.1 Score: 741 E_value: 7e-77
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG2552 Score: 515 E_value: 6e-53
PFAM Definition: PIG-U, GPI transamidase subunit PIG-U. Many eukaryotic proteins are anchored to the cell surface via glycosylphosphatidylinositol (GPI), which is posttranslationally attached to the carboxyl-terminus by GPI transamidase. The mammalian GPI transamidase is a complex of at least four subunits, GPI8, GAA1, PIG-S, and PIG-T. PIG-U is thought to represent a fifth subunit in this complex and may be involved in the recognition of either the GPI attachment signal or the lipid portion of GPI..
Pfam Number: pfam06728 Score: 261 E_value: 2e-23
Swissprot: P41733|CDC91_YEAST
Gene Ontology:
GO:0042765 = Cellular component: GPI-anchor transamidase complex

Sequence:
>Contig1706
TTGGCGCCCTCCTTTTGTTCTTTTCTTGACTACTTCTCAACAATCCTACG
ACTCTCTCTTTCCCTCTACCTTTCTCCTCGGCCAGGACACAATGGACCGG
CGGAGTTTCACCGTCATTTTTGCCGCGGTGGTACTCAGACTGGTTCTGTT
CACGGCGTTCCCCTCGCTACCTGACCTACTGACCAATCGTGTGGAACTGT
CTACGCCTGTAACGAGCTTCAAACGGTTACAGGAGGGTCTGTTCTTGTAT
ACCCATGGATTGTCACCTTATGATGGGGGGGTCTTTCATCAGGCCCCATT
GCTGCTAGCGTTCTTCACAACACTCCCGTCGAATCCAATCGTCGTTTACC
TAGTCTACATACTTTCGGACGTGCTCTCGGCACACTCACTCATACAAATC
GCAACCTCGGGAGTGAGCGTTTCGACACCGTACCACACCTCGCCCAGGAA
ATCTTCAACTTGGCCGCCATGGGCCGTCGCCGCAGCATTCTTGTTCAACC
CGTTCTCTATTGCAACTTGTATTGCTCGCCCGACGATCGTGTTCACAAAT
ACTGTGATTCTGACGGCTATTGCGAAGGGGGTTCAAGGACAGGGTGTTGC
CGCTGTGTTAGCTCTCGCAATGGCTTCGTACTTGTCACTTTACCCCGTGC
TATTGCTCCCGCCGATGGTCCTGCTAGCGTACGACTCCCTGCCAGTGGTG
AAGAAGGGGCGCTATCTCGGGAGCTTTGCCGTTATGTTGACTTCTGTGTT
TACCGTTGCGGCAGCGGGACTCGGCGCGTTGTCATGGGGGATCACGGGCG
GGAGTTGGGAGTTTCTAGCATCGACGTATGGGGTGCATCTGCTGCTGCCG
GATCTGACGCCGAATGTAGGGCTTTGGTGGTACTTTTTCATAGAGATGTT
TGATTCGTTCCGAGAGTTCTTTCTATGCGTTTTTCAGTTGCATTTGGCGG
TTTATTTGGCGGGATTGTGCCTGCGGTTGAGGAAACAACCTCTATTTGTG
AT

Sequences in the Contig:

SY0AAA34YF23FM1 SY0AAA56YI20FM1 SY0AAA5YC16FM1
SY0AAB23YN07FM1 SY0AAD5YA14FM1