Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1705
Length(NT) : 1084
Best Gene Model Blast : Link to GSTUMT00004609001 E-value : 0.0
Numbers of ESTs : 11

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Transcription].
Kog Number: KOG3598 Score: 157 E_value: 2e-11
PFAM Definition: DUF1421, Protein of unknown function (DUF1421). This family represents a conserved region approximately 350 residues long within a number of plant proteins of unknown function..
Pfam Number: pfam07223 Score: 129 E_value: 3e-08

Sequence:
>Contig1705
TTGGCCCATACCACTTGGCCTGCATTTCCGGAAGCTAATTCTTTGGTATC
ATAAAGAGAAGAAAAGAAAGAAAAAAAAAAAAAGGAAGAGTCCCTCGTCC
AGCGATGAGGGATAAGCGCTGGAATGCCGTTGCTCTTCTGATCCTGCGCA
TATCACAGCTTGTGCTGGCTGTGATTGCGCTAGGACTGGCCGCTTTCTTC
ATAGCTAAATACCCTGTCGCATGGTATGCAGCCTTCACCCTCACCACTAT
CTGCTTAACCGTTGTCTGGATCCCCCTAGTCCTAGGCCTCTTCTTCACGG
GCAACCTCCTCCCATTAGTCGTGATAATCGTAGACGTACTCATAGCAATA
TTCTACATCATCTCGATCGCCACAATCGCAGATTACAACCCTGAAGCCAT
CGGCGGGTCCTGCGCCTTCTACACCTTCTCGCTATGGGACTGGGACACGT
ACTTGTGGGTGATCGAGGACTGCGACAAGCTGAGGGGCCTATTCGCCATA
CTGGTCTTGGAAATGTTGACGTTCATCGGCGCGATTATTTGGGACGGCGT
CGTCCTGTACCAGAATCGCAGTGGGAGGGCTGGGGCTGTTGACGCCGTTG
CGCAGAATGCCATGTATGGCGGCGCCGGCGCCGGACGGGTAGCGGCGGTA
GGGGGAACGTATGGGGTGTCGAAACCTATGATGAACGATGCGGCTGGATA
CTATGGGGGACAGACCTCTCTGCCACAGTACCAGCCCATGAATTCCCCGA
CTTATCCACCTCAGGTCGGATCACCAATCAGTCCGTATAGTCCTTACGTG
CCACCGCCCGTGGCACCGACGATGCCACAGCAGGCCGCCGTGATGCAGCA
CCAACATCAGAACCATCTGCAGCAACAGCAGGTTCACCAGTTACAACAAC
AGCAACGTCAGCACCAACAACAACAACAACCGCAGCAACAACATCATCAG
TTCCAGCCGCCGCCGCCGCCGCCGCCGCCGCAGCAGCAGCAGCAGAATCA
AGGACCGTTGCCACATGAGTTGGGTGGAATGCATTAGTGGTAGTGGAGTT
TCCTATTGTTTTGATGATATGGCTTTGTTTATGA

Sequences in the Contig:

SY0AAA31YJ14FM1 SY0AAA34YA11FM1 SY0AAA5YB14FM1
SY0AAB11YE07FM1 SY0AAB12YG12FM1 SY0AAB23YJ11FM1
SY0AAB27YI08FM1 SY0AAB27YK08FM1 SY0AAB58YN08FM1
SY0AAB60YL12FM1 SY0AAB8YG02FM1