Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1704
Length(NT) : 2131
Best Gene Model Blast : Link to GSTUMT00006083001 E-value : 0.0
Numbers of ESTs : 6

Blast Results:

Nr Definition: hypothetical protein AN6551.2
Accession: ref|XP_664155.1| Score: 473 E_value: 2e-86
KEGG Definition: hypothetical protein
Accession: ani:AN6551.2 Score: 473 E_value: 9e-87
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1704
TTGGGCCTATATGATCGTTCGTGAGCCGGACCGTTTACTCGATGTCTTCG
GCGGCGAGAAGAAATACATGGGGGCCTTGAGAAGTATCGCAGAGAATTGG
AGCCACTTGAAGAAAGACAGAATGCTCCTCAAGGAGATGCGGAAGAGTCG
GTTTCTCGGAGCGCTGAGAGAAGTTTCGGCCGGCAACGGAGCTGATGCAA
GTGCCGCCGAAGAAAACGCCGATGGAGGTACCATCAAGGAGTTTACTCTG
GCTAGGGCAGACCAGGTTTTGGTGATCGATGAATATGTGACTTACGTCAT
GTTCAAGAGCGAGATTCTGACAGCCCCGCAAGAGGACATTCTAGAGAGTT
TTTATACGGCTTTAGGCGCTTCGGCTGTGTCAGCGAGGGTCTTTCCTGAA
TGGCGCATTGGGAATCCGATACACGCGGAGAGAGAGGTAGAAAAGTTGAG
TAAGCTTGTTTTGGAGAGGTGTCGTTTATTTCTTCATAACAACAATGAAG
AAGTTGCACACGATGCCCGGTGGCTGGAGAACAATCTGCGAGTTTCGTAT
GTTGATACCATCCGTGTGAAGAATACCCTGAGGCACGAAGGATATAAAAC
AATTAGTCATCTGCAGGGCAAGACTGCTTCGATAACGAAGGATACTGTCA
CGAAGCAGATTATTTTGTATGTGACTCGTGGTTTCTTGTATTACGACGTC
TCGGTGGGACTCGTTTCTATCATACTTAGGCGGCCTAAACCGCATTCTTA
TTTGCTGCTGGAGAGTTTGTTAAGCACTGACCTGATGGTACTAAAGTCAC
GGGGCTTTAACGTTGAACGGATTCTAAAAGCAAAAGCCGCTGAGGCTCGT
ATTGCAGAAAACCAGCGTCTGAGGAGGCTCGACGAAGAACGACGGAAGTT
CGAAGAAGAGGAGAAGCTGGCACGTGAAAAGGAGAAGCTGCAGCAGAAGC
AGATTTTGCCGGAGCAAACGAAGCAAGCTACCCGAGAGCCGGAGGAGCGA
TTTGCTATGCCGGGTGCATTTACTGAACCGGTCCCTCCCATCGTGGATAG
ACCGAGGACGAATAACTTCTTCGGGAAGATTACTAAAACTCTTGGTCTTG
ATAAGGATAGCCAGCAAACAGAGCAAATAAAGGATTTCCTCGATTACCAG
TCTCCCGAGCAACATCACCAAGCGCAGTTACAAATAAAGCCGACCTCACA
CGCGCAGCCACAAGTGGGAGAAGCCTACCGAACCTCATAGAATTAGGGAG
AACCTGCGTAGAGCAGTGGAATCTAGTAGAAGCCATGACTCTAATGACTT
GTTCAACCTTCCGGAAACTTTGGTGGTTAAGGAGCAGAAGAGCTATTGCG
ACTCTCGCCCGAGCCACGATATCACCTTTGCAGGATATTCCGCTCTGGGG
ATCAAGTTGTATGTCGACAGGAAGGCGAAGGAGCAAGATATTTTCGGCAA
AAACGCCGCGGCTGTCAATTCGTTCTCCAAACTGCTGAAGGAAATCTCTG
AGATATATTCCCTCAGAATCGCCTCGATGCACATTTACTTTGATGAGCAA
GGGACATCGATTGCGTTTAATACTAGTGGTTCAATATTCTGCAATCTCCG
TTTCTTCCTAGAACTCCACGGTGAAGCAGTTGCTAAAGGCGATACGGAGA
AAGCGTTGGCGTACTGGTTCGTTGTTGTCGCACATGAGCTGGCGCATAAT
CTCGTCCCGGAACATTCTGCACAGCATTCCTTTTATGCCGAAACGTTTAC
ACAGGAATACTTTATCAGGGCCATGGCGGCAATTCAGAAGGGGAGGGAAG
CGAAGACTCAATAATCTAGTTTTGCTTAGATAGAGGGATTTAGACTTTGA
TGGGGTTTTTTTTTTTTTTTGCTTAGACCCTTGACAGGGCTCGGAATTTG
GATTTGTGTCATTGTCGTTAGCTGTAGTTTGGCTATGATATCCTGGGTAA
AATGTTTTTTTTCTTTCTTCCTTTTCTTTATTACCTTTTTGGGCGGGGCT
GTGCTGGAATCTGTCGTTCGCGATCGCGATAATTGAATTCTTGGGATTTG
TGTACTGTGCAGGTCTTGGTCATATTTTATCACTCGGGGCACCCTACACG
ATTGTTTGACATGCGGGTGGAAACACGGCAG

Sequences in the Contig:

SY0AAA22YH12FM1 SY0AAA44YF03FM1 SY0AAA5YB10FM1
SY0AAD26YA14FM1 SY0AAD41YD11FM1 SY0AAD45YC14FM1